ptre11 expresses treA from pBR322 under control of its own promoter. treA expresses periplasmic trehalase A from E. coli

Reference:
Gutierrez, J. A., Ardourel, M., Bremer, E., Middendorf, A., Boos, W. and Ehmann, U. (1989) Mol. Gen. Genet. 217, 347-354

comments:
EcoRI-BamHI frg of ECD026.68 into EcoRI-BamHI of pBR322 (reverse complement)
treA ATG 4479;
treA TAA 6174


TTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCA TGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTG CGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGA AGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCG GCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAA AGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATC TCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCA ATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGT TGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATG ACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATG ACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGC GGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTT TTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCG GAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGC AGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTC TAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCA GGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAA ATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGC CAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAG GCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACT GATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGA TTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTT TTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTG AGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTT TTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCG GTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAAC TGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGT AGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCT CTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCT TACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGG GCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTAC ACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCC CGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAG GAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGT CCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTC GTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTAC GGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTA TCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATAC CGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAG CGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATT TCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATA GTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGC GCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGC TCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATG TGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTA AAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGATGTCTGCCTGTTCAT CCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTG ATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGATGC CTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAAC GAGAGAGGATGCTCACGATACGGGTTACTGATGATGAACATGCCCGGTTA CTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCA GAGAAAAATCACTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAG GTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATA ATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAA ACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGC AGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTA AGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCAT GCGCACCCGTGGCCAGGACCCAACGCTGCCCGAGATGCGCCGCGTGCGGC TGCTGGAGATGGCGGACGCGATGGATATGTTCTGCCAAGGGTTGGTTTGC GCATTCACAGTTCTCCGCAAGAATTGATTGGCTCCAATTCTTGGAGTGGT GAATCCGTTAGCGAGGTGCCGCCGGCTTCCATTCAGGTCGAGGTGGCCCG GCTCCATGCACCGCGACGCAACGCGGGGAGGCAGACAAGGTATAGGGCGG CGCCTACAATCCATGCCAACCCGTTCCATGTGCTCGCCGAGGCGGCATAA ATCGCCGTGACGATCAGCGGTCCAGTGATCGAAGTTAGGCTGGTAAGAGC CGCGAGCGATCCTTGAAGCTGTCCCTGATGGTCGTCATCTACCTGCCTGG ACAGCATGGCCTGCAACGCGGGCATCCCGATGCCGCCGGAAGCGAGAAGA ATCATAATGGGGAAGGCCATCCAGCCTCGCGTCGCGAACGCCAGCAAGAC GTAGCCCAGCGCGTCGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGC CGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGC AAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCG AAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTA CGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATG CCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCAT CGGTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTA GTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCAAG GAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCAC GCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCAT CGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTG ATGCCGGCCACGATGCGTCCGGCGTAGAGGATCcggttgtaaaaggtatc tgccttagcgccggaagtccggtatcccacagcgccctaatcgcccgtga actggggattggctggatttgccagcagggtgagaaactgtatgcgatac aaccagaagaaacgctaacgctggacgttaaaacgcaacgtttcaaccgt cagggttaagccactgttcggatggcatcgttctgatgtcatccggcaat ttactcagcactaatggtttttaactacctgttatatttttcaccaattt atgatgatttttcttcgctaatcacgaacccaacgccgctggctggctaa taaacagacgttatttgatcactctatttcgccgttatttatccctttaa ttcccttttctaaaatgcctgacagttcgcagaatgagatttcgatcatg cagctagtgcgatcctgaactaaggttttctgatacttgaataccgtttt attcggtttcgccaaaggagaatgattgATGaaatcccccgcaccttctc gcccgcaaaaaatggcgttaattccagcctgtatctttttgtgtttcgct gcgctatcggtgcaggcagaagaaacaccggtaacaccacagccgcctga tattttattagggccgctgtttaatgatgtgcaaaacgccaaactttttc cggaccaaaaaacctttgccgatgccgtgccgaacagcgatccgctgatg atccttgctgattatcggatgcagcaaaaccagagcggatttgatctgcg ccatttcgttaacgtcaatttcaccctgccgaaagaaggcgagaaatatg ttccgccagaggggcagtcactgcgcgaacatattgacggactttggccg gtattaacgcgttctaccgaaaacaccgaaaaatgggattctctgttacc gctgccggaaccttatgtcgtgccgggcggacgctttcgcgaggtatatt actgggacagttacttcaccatgttaggacttgccgaaagcggtcactgg gataaagtcgcggatatggtggccaattttgctcatgaaatagacactta cggtcatattcccaacggcaaccgcagttactatttaagccgctcgcaac cgcccttctttgccctgatggtagagttactggcgcagcatgaaggcgat gccgcgttgaagcaatacctgccgcaaatgcaaaaagaatatgcttactg gatggacggtgttgaaaacctgcaagccggacaacaggaaaaacgcgttg tcaaacttcaggatggtacccttctcaaccgctactgggacgatcgcgat acgccacgaccagagtcatgggtggaagatattgccaccgccaaaagcaa tccgaatcgacctgccactgaaatttaccgcgacctgcgctctgccgctg cgtctggctgggatttcagctcgcgctggatggacaacccgcagcagtta aataccttacgcaccaccagcatcgtaccggtcgatctgaacagcctgat gtttaaaatggaaaaaatcctcgcccgcgccagcaaagctgccggagata acgcgatggcaaaccagtacgaaacgctggcaaatgcccgtcaaaaaggg atcgaaaaatacctgtggaacgatcaacaaggctggtatgccgattacga cctgaaaagtcataaagtgcgcaatcagttaaccgcggccgccctgttcc cgctgtacgtcaatgcggcagcgaaagatcgcgccaacaaaatggcgacg gcgacgaaaacacatctgctgcaacccggcggcctgaacaccacgtcggt gaaaagtgggcaacaatgggatgcgccaaatggctgggcaccgttacagt gggtcgcgacagaaggattacaaaactacgggcaaaaagaggtggcgatg gacattagctggcacttcctgaccaatgttcagcacacctatgaccggga gaaaaagctggtggaaaaatatgatgtcagcaccaccggaacggggggcg gcggtggcgaatatccattacaggatggctttggctggaccaatggcgtg acgctgaaaatgctggatttgatctgcccgaaagagcaaccgtgtgacaa tgttccggcgacgcgtccgaccgttaagtcagcaacgacgcaaccctcaa ccaaagaggcacaacccacaccttaaccagcgcttactccgacaacgtca ttcggcttctccggatggcgttgtcggcagataacaccatagctatggtt ttttctacacagacggtttttcaagtcctggcgggaagtattgcgcaaat gtttgccatacgtggttgccgaagatagcgtcatttctacgggtaagtgt ttcactttcatcacccggcgatttacgccgacgttggctatataaagcat caattgctacctgaatattgttacggtgttcactcatcaacgtttttttg ctttctggagttaaattaataatcacataatccagacactccagagaatt tagcaaccaaaaaaagaattc



Back to Vector page
Back to Homepage