pSWFIII

- Reference:

unpublished

Sequence of the phoA cassette in pSWFIII used for the construction of phoA and phoA sandwich fusions. uppercase: signal sequenceless phoA from TnphoA lacking its stop codon. lowercase:flanking restriction sites
pSWFIII is derived from pSWFII (pSWFII was cut BstEII filled with Klenow and religated).

aagcttgcatgcctgcaggtcgactctagaggatccccgggtacctgact ctgactcttatacacaagtagcgtcctggacggaacctttcccgttttgc CCTGTTCTGGAAAACCGGGCTGCTCAGGGCGATATTACTGCACCCGGCGG TGCTCGCCGTTTAACGGGTGATCAGACTGCCGCTCTGCGTGATTCTCTTA GCGATAAACCTGCAAAAAATATTATTTTGCTGATTGGCGATGGGATGGGG GACTCGGAAATTACTGCCGCACGTAATTATGCCGAAGGTGCGGGCGGCTT TTTTAAAGGTATAGATGCCTTACCGCTTACCGGGCAATACACTCACTATG CGCTGAATAAAAAAACCGGCAAACCCGACTACGTCACCGACTCGGCTGCA TCAGCAACCGCCTGGTCAACCGGTGTCAAAACCTATAACGGCGCGCTGGG CGTCGATATTCACGAAAAAGATCACCCAACGATTCTGGAAATGGCAAAAG CCGCAGGTCTGgCGACCGGTAACGTTTCTACCGCAGAGTTGCAGGATGCC ACGCCCGCTGCGCTGGTGGCACATGTGACCTCGCGCAAATGCTACGGTCC GAGCGCGACCAGTGAAAAATGTCCGGGTAACGCTCTGGAAAAAGGCGGAA AAGGATCGATTACCGAACAGCTGCTTAACGCTCGTGCCGACGTTACGCTT GGCGGCGGCGCAAAAACCTTTGCTGAAACGGCAACCGCTGGTGAATGGCA GGGAAAAACGCTGCTGGAACAGGCACAGGCGCGTGGTTATCAGTTGGTGA GCGATGCTGCCTCACTGAATTCGGTGACGGAAGCGAATCAGCAAAAACCC CTGCTTGGCCTGTTTGCTGACGGCAATATGCCAGTGCGCTGGCTAGGACC GAAAGCAACGTACCATGGCAATATCGATAAGCCCGCAGTCACCTGTACGC CAAATCCGCAACGTAATGACAGTGTACCAACCCTGGCGCAGATGACCGAC AAAGCCATTGAATTGTTGAGTAAAAATGAGAAAGGCTTTTTCCTGCAAGT TGAAGGTGCGTCAATCGATAAACAGGATCATGCTGCGAATCCTTGTGGGC AAATTGGCGAGACGGTCGATCTCGATGAAGCCGTACAACGGGCGCTGGAA TTCGCTAAAAAGGAGGGTAACACGCTGGTCATAGTCACCGCTGATCACGC CCACGCCAGCCAGATTGTTGCGCCGGATACCAAAGCTCCGGGCCTCACCC AGGCGCTAAATACCAAAGATGGCGCAGTGATGGTGATGAGTTACGGGAAC TCCGAAGAGGATTCACAAGAACATACCGGCAGTCAGTTGCGTATTGCGGC GTATGGCCCGCATGCCGCCAATGTTGTTGGACTGACCGACCAGACCGATC TCTTCTACACCATGAAAGCCGCTCTGGGGCTGAAAggttacgttaccgga tcccaagcttcttcTAGaggtaccgcatgcgatatcgagct



Back to Vector page
Back to Homepage