pSWFII

- Reference:

Ehrmann et al. 1990. PNAS 87: 7574-7578.

Sequence of the phoA cassette in pSWFII used for the construction of phoA and phoA sandwich fusions. uppercase: signal sequenceless phoA from TnphoA lacking its stop codon. lowercase:flanking restriction sites

aagcttgcatgcctgcaggtcgactctagaggatccccgggtacctgact ctgactcttatacacaagtagcgtcctggacggaacctttcccgttttgc CCTGTTCTGGAAAACCGGGCTGCTCAGGGCGATATTACTGCACCCGGCGG TGCTCGCCGTTTAACGGGTGATCAGACTGCCGCTCTGCGTGATTCTCTTA GCGATAAACCTGCAAAAAATATTATTTTGCTGATTGGCGATGGGATGGGG GACTCGGAAATTACTGCCGCACGTAATTATGCCGAAGGTGCGGGCGGCTT TTTTAAAGGTATAGATGCCTTACCGCTTACCGGGCAATACACTCACTATG CGCTGAATAAAAAAACCGGCAAACCCGACTACGTCACCGACTCGGCTGCA TCAGCAACCGCCTGGTCAACCGGTGTCAAAACCTATAACGGCGCGCTGGG CGTCGATATTCACGAAAAAGATCACCCAACGATTCTGGAAATGGCAAAAG CCGCAGGTCTGgCGACCGGTAACGTTTCTACCGCAGAGTTGCAGGATGCC ACGCCCGCTGCGCTGGTGGCACATGTGACCTCGCGCAAATGCTACGGTCC GAGCGCGACCAGTGAAAAATGTCCGGGTAACGCTCTGGAAAAAGGCGGAA AAGGATCGATTACCGAACAGCTGCTTAACGCTCGTGCCGACGTTACGCTT GGCGGCGGCGCAAAAACCTTTGCTGAAACGGCAACCGCTGGTGAATGGCA GGGAAAAACGCTGCTGGAACAGGCACAGGCGCGTGGTTATCAGTTGGTGA GCGATGCTGCCTCACTGAATTCGGTGACGGAAGCGAATCAGCAAAAACCC CTGCTTGGCCTGTTTGCTGACGGCAATATGCCAGTGCGCTGGCTAGGACC GAAAGCAACGTACCATGGCAATATCGATAAGCCCGCAGTCACCTGTACGC CAAATCCGCAACGTAATGACAGTGTACCAACCCTGGCGCAGATGACCGAC AAAGCCATTGAATTGTTGAGTAAAAATGAGAAAGGCTTTTTCCTGCAAGT TGAAGGTGCGTCAATCGATAAACAGGATCATGCTGCGAATCCTTGTGGGC AAATTGGCGAGACGGTCGATCTCGATGAAGCCGTACAACGGGCGCTGGAA TTCGCTAAAAAGGAGGGTAACACGCTGGTCATAGTCACCGCTGATCACGC CCACGCCAGCCAGATTGTTGCGCCGGATACCAAAGCTCCGGGCCTCACCC AGGCGCTAAATACCAAAGATGGCGCAGTGATGGTGATGAGTTACGGGAAC TCCGAAGAGGATTCACAAGAACATACCGGCAGTCAGTTGCGTATTGCGGC GTATGGCCCGCATGCCGCCAATGTTGTTGGACTGACCGACCAGACCGATC TCTTCTACACCATGAAAGCCGCTCTGGGGCTGAAAggttaccggatccca agcttcttcTAGaggtaccgcatgcgatatcgagct



Back to Vector page
Back to Homepage