pNTH1

- Reference: unpublished



CTCGAGAAATCATAAAAAATTTATTTGCTTTGTGAGCGGATAACAATTAT AATAGATTCAATTGTGAGCGGATAACAATTTCACACAGAATTCATTAAAG AGGAGAAATTAACTATGAGAGGATCTCACCATCACCATCACCATACGGAT CCGCATGCGAGCTCGGTACCCCGGGTCGACCTGCAGCCAAGCTTAATTAG CTGAGCTTGGACTCCTGTTGATAGATCCAGTAATGACCTCAGAACTCCAT CTGGATTTGTTCAGAACGCTCGGTTGCCGCCGGGCGTTTTTTATTGGTGA GAATCCAAGCTAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATG GAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCG TAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACC AGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAAT AAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAA TGCTCATCCGGAATTTCGTATGGCAATGAAAGACGGTGAGCTGGTGATAT GGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACG TTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACA CATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCC CTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTG AGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGC CCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGA TGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTGATGGCTTCCATGTC GGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGG GGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGGGTAA TGACTCTCTAGCTTGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGA CTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTA GGACAAATCCGCCGCTCTAGattaccgtgcagtcgatgataagctgtcaa acatgagaattgtgcctaatgagtgagctaactcacattaattgcgttgc gctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaa tgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgccaggg tggtttttcttttcaccagtgagacgggcaacagctgattgcccttcacc gcctggccctgagagagttgcagcaagcggtccacgctggtttgccccag caggcgaaaatcctgtttgatggtggttaacggcgggatataacatgagc tgtcttcggtatcgtcgtatcccactaccgagatatccgcaccaacgcgc agcccggactcggtaatggcgcgcattgcgcccagcgccatctgatcgtt ggcaaccagcatcgcagtgggaacgatgccctcattcagcatttgcatgg tttgttgaaaaccggacatggcactccagtcgccttcccgttccgctatc ggctgaatttgattgcgagtgagatatttatgccagccagccagacgcag acgcgccgagacagaacttaatgggcccgctaacagcgcgatttgctggt gacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatgg gagaaaataatactgttgatgggtgtctggtcagagacatcaagaaataa cgccggaacattagtgcaggcagcttccacagcaatggcatcctggtcat ccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattg tgcaccgccgctttacaggcttcgacgccgcttcgttctaccatcgacac caccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaa tttgcgacggcgcgtgcagggccagactggaggtggcaacgccaatcagc aacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaatt cagctccgccatcgccgcttccactttttcccgcgttttcgcagaaacgt ggctggcctggttcaccacgcgggaaacggtctgataagagacaccggca tactctgcgacatcgtataacgttactggtttcattcaccaccctgaatt gactctcttccgggcgctatcatgccataccgcgaaaggttttgcaccat tcgatggtgtcggaatttcgggcagcgttgggtcctggccacgggtgcgc atgatctagAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTG ACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCG GGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGG GGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTT AACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTG TGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTT CCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCTGTCGGCTGCGGCGA GCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGG GGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGA ACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCT GACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGAC AGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCT CTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCT TCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTC GGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTC AGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCG GTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAG CAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTA ACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAG CCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAAC CACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCA GAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGAC GCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC AAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAAT CAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTA ATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGC TGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCAT CTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCA GATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGG TCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAG CTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATT GCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAG CTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCA AAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTG GCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTAC TGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCA AGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCG TCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCAT CATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGT TGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCA TCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAA TGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATAC TCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATG AGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCC GCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTA TCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTT CAC



Back to DNA page
Back to Homepage