pMM13

pMM13 is a pACYC184 derived plasmid that is TetR and has medium copy number. Expression of TEV protease is induced by IPTG. We recommend replacing tryptone in rich medium by NZ amine A because the latter does not contain lactose which induces the tac promoter. The GST-TEV protease hybrid is expressed as an inclusion body in the presence of high IPTG. Soluble (and active) TEV protease is best obtained at 50 µM IPTG.

- Reference:
Ehrmann, M., Bolek, P., Mondigler, M., Boyd D. and R. Lange 1997. TnTIN and TnTAP: mini-transposons for site specific proteolysis in vivo. Proc. Natl. Acad. Sci. USA 94: 13111-13115

Ptac 1919-1947
GST cds 1994-2665
TEV protease cds 2666-3368 (ApaI-BspHI filled of pGEX2T-27k into ApaI-XmnI of pACYC184 lacIQ
; end of insert 3317)
(pACYC184 used here has lacIQ
inserted into EcoRI. The insert is not well defined, so expect surprises)

GAATTCgacaccatcgaatggTgcaaaacctttcgcggtatggcatgata gcgcccggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgt tatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgc gtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtgga agcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaac tggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggcc ctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatca actgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaag cctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctg atcattaactatccgctggatgaccaggatgccattgctgtggaagctgc ctgcactaatgttccggcgttatttcttgatgtctctgaccagacaccca tcaacagtattattttctcccatgaagacggtacgcgactgggcgtggag catctggtcgcattgggtcaccagcaaatcgcgctgttagcGGGCCCATT AAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCA CTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCC ATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCC CACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCG CCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGA TACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCAT CAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGC AACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCA CTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCC CCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGAC TGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCA TTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTG GAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGAT TACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG GCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGG CGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAG CCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGC CGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTC CCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGT AACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGA CGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAA GGCCAGACGCGAATTATTTTTGATGGCGTTGGAATTACGTTATCGACTGC ACGGTGCACCAATGCTTCTGGCGTCAGGCAGCCATCGGAAGCTGTGGTAT GGCTGTGCAGGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCAC TCCCGTTCTGGATAATGTTTTTTGCGCCGACATCATAACGGTTCTGGCAA ATATTCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGT GGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGTATTCATGTCCC CTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCACTCGACTT CTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTATGAGCGCGA TGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTC CCAATCTTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATG GCCATCATACGTTATATAGCTGACAAGCACAACATGTTGGGTGGTTGTCC AAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGAGCGGTTTTGGATATTA GATACGGTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCAAA GTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCGAAGATCG TTTATGTCATAAAACATATTTAAATGGTGATCATGTAACCCATCCTGACT TCATGTTGTATGACGCTCTTGATGTTGTTTTATACATGGACCCAATGTGC CTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTAT CCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTT TGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCG GATCTGGTTCCGCGTGGATCCTTGTTTAAGGGACCACGTGATTACAACCC GATATCGAGCACCATTTGTCATTTGACGAATGAATCTGATGGGCACACAA CATCGTTGTATGGTATTGGATTTGGTCCCTTCATCATTACAAACAAGCAC TTGTTTAGAAGAAATAATGGAACACTGTTGGTCCAATCACTACATGGTGT ATTCAAGGTCAAGAACACCACGACTTTGCAACAACACCTCATTGATGGGA GGGACATGATAATTATTCGCATGCCTAAGGATTTCCCACCATTTCCTCAA AAGCTGAAATTTAGAGAGCCACAAAGGGAAGAGCGCATATGTCTTGTGAC AACCAACTTCCAAACTAAGAGCATGTCTAGCATGGTGTCAGACACTAGTT GCACATTCCCTTCATCTGATGGCATATTCTGGAAGCATTGGATTCAAACC AAGGATGGGCAGTGTGGCAGTCCATTAGTATCAACTAGAGATGGGTTCAT TGTTGGTATACACTCAGCATCGAATTTCACCAACACAAACAATTATTTCA CAAGCGTGCCGAAAAACTTCATGGAATTGTTGACAAATCAGGAGGCGCAG CAGTGGGTTAGTGGTTGGCGATTAAATGCTGACTCAGTATTGTGGGGGGG CCATAAAGTTTTCATGgcttcatgtggcaggagaaaaaaggctgcaccgg tgcgtcagcagaatatgtgatacaggatatattccgcttcctcgctcact gactcgctacgctcggtcgttcgactgcggcgagcggaaatggcttacga acggggcggagatttcctggaagatgccaggaagatacttaacagggaag tgagagggccgcggcaaagccgtttttccataggctccgcccccctgaca agcatcacgaaatctgacgctcaaatcagtggtggcgaaacccgacagga ctataaagataccaggcgtttcccctggcggctccctcgtgcgctctcct gttcctgcctttcggtttaccggtgtcattccgctgttatggccgcgttt gtctcattccacgcctgacactcagttccgggtaggcagttcgctccaag ctggactgtatgcacgaaccccccgttcagtccgaccgctgcgccttatc cggtaactatcgtcttgagtccaacccggaaagacatgcaaaagcaccac tggcagcagccactggtaattgatttagaggagttagtcttgaagtcatg cgccggttaaggctaaactgaaaggacaagttttggtgactgcgctcctc caagccagttacctcggttcaaagagttggtagctcagagaaccttcgaa aaaccgccctgcaaggcggttttttcgttttcagagcaagagattacgcg cagaccaaaacgatctcaagaagatcatcttattaatcagataaaatatt tctagatttcagtgcaatttatctcttcaaatgtagcacctgaagtcagc cccatacgatataagttgtaattctcatgtttgacagcttatcatcgata agctttaatgcggtagtttatcacagttaaattgctaacgcagtcaggca ccgtgtatgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcac cctggatgctgtaggcataggcttggttatgccggtactgccgggcctct tgcgggatatcgtccattccgacagcatcgccagtcactatggcgtgctg ctagcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagc actgtccgaccgctttggccgccgcccagtcctgctcgcttcgctacttg gagccactatcgactacgcgatcatggcgaccacacccgtcctgtggatc ctctacgccggacgcatcgtggccggcatcaccggcgccacaggtgcggt tgctggcgcctatatcgccgacatcaccgatggggaagatcgggctcgcc acttcgggctcatgagcgcttgtttcggcgtgggtatggtggcaggcccc gtggccgggggactgttgggcgccatctccttgcatgcaccattccttgc ggcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgc aggagtcgcataagggagagcgtcgaccgatgcccttgagagccttcaac ccagtcagctccttccggtgggcgcggggcatgactatcgtcgccgcact tatgactgtcttctttatcatgcaactcgtaggacaggtgccggcagcgc tctgggtcattttcggcgaggaccgctttcgctggagcgcgacgatgatc ggcctgtcgcttgcggtattcggaatcttgcacgccctcgctcaagcctt cgtcactggtcccgccaccaaacgtttcggcgagaagcaggccattatcg ccggcatggcggccgacgcgctgggctacgtcttgctggcgttcgcgacg cgaggctggatggccttccccattatgattcttctcgcttccggcggcat cgggatgcccgcgttgcaggccatgctgtccaggcaggtagatgacgacc atcagggacagcttcaaggatcgctcgcggctcttaccagcctaacttcg atcactggaccgctgatcgtcacggcgatttatgccgcctcggcgagcac atggaacgggttggcatggattgtaggcgccgccctataccttgtctgcc tccccgcgttgcgtcgcggtgcatggagccgggccacctcgacctgaatg gaagccggcggcacctcgctaacggattcaccactccaagaattggagcc aatcaattcttgcggagaactgtgaatgcgcaaaccaacccttggcagaa catatccatcgcgtccgccatctccagcagccgcacgcggcgcatctcgg gcagcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgttg aggacccggctaggctggcggggttgccttactggttagcagaatgaatc accgatacgcgagcgaacgtgaagcgactgctgctgcaaaacgtctgcga cctgagcaacaacatgaatggtcttcggtttccgtgtttcgtaaagtctg gaaacgcggaagtcccctacgtgctgctgaagttgcccgcaacagagagt ggaaccaaccggtgataccacgatactatgactgagagtcaacgccatga gcggcctcatttcttattctgagttacaacagtccgcaccgctgtccggt agctccttccggtgggcgcggggcatgactatcgtcgccgcacttatgac tgtcttctttatcatgcaactcgtaggacaggtgccggcagcgcccaaca gtcccccggccacggggcctgccaccatacccacgccgaaacaagcgccc tgcaccattatgttccggatctgcatcgcaggatgctgctggctaccctg tggaacacctacatctgtattaacgaagcgctaaccgtttttatcaggct ctgggaggcagaataaatgatcatatcgtcaattattacctccacgggga gagcctgagcaaactggcctcaggcatttgagaagcacacggtcacactg cttccggtagtcaataaaccggtaaaccagcaatagacataagcggctat ttaacgaccctgccctgaaccgacgaccgggtcgaatttgctttcgaatt tctgccattcatccgcttattatcacttattcaggcgtagcaccaggcgt ttaagggcaccaataactgccttaaaaaaattacgccccgccctgccact catcgcagtactgttgtaattcattaagcattctgccgacatggaagcca tcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtc gccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgt ccatattggccacgtttaaatcaaaactggtgaaactcacccagggattg gctgagacgaaaaacatattctcaataaaccctttagggaaataggccag gttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgcc ggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgc tcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctc accgtctttcattgccatacg



Back to Vector page
Back to Homepage