pHSG575

- Reference:

Takeshita, S; Sato, M; Toba, M; Masahashi, W; Hashimoto-Gotoh, T (1987) Gene 61, 63-74

bp 0-1324 pACYC184 (corresponding to bp 585-3505 of reverse pACYC184)
cat gene 362(ATG)-1021(TAA)
lacI+Zę 1325-1748 (reverse)
Polylinker 1484-1514
bp 1749-3629 pSC101 (corresponding to bp 6643-4763 reverse)
repA 2170(stop)-3120(start)
ori 3100-3500

TGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGA ACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAAC ACCATCATACACTAAATCACTAAGTTGGCAGCATCACCCGACGCACTTTG CGCCGAATAAATACCTGTGACGGAAGATCACTTCGCAGAATAAATAAATC CTGGTGTCCCTGTTGATACCGGGAAGCCCTGGGCCAACTTTTGGCGAAAA TGAGACGTTGATCGGCACGTAAGAGGTTCCAACTTTCACCATAATGAAAT AAGATCACTACCGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAGCTA AGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATA TCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCA ATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGA CCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTT GCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGG TGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATG AGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTC CGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAA CCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAG CCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATG GACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGG CGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCTGTG ATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGAT GAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCTTA AACGCCTGGTGCTACGCCTGAATAAGTGATAATAAGCGGATGAATGGCAG AAATTCGAAAGCAAATTCGACCCGGTCGTCGGTTCAGGGCAGGGTCGTTA AATAGCCGCTTATGTCTATTGCTGGTTTACCGGTTTATTGACTACCGGAA GCAGTGTGACCGTGTGCTTCTCAAATGCCTGAGGCCAGTTTGCTCAGGCT CTCCCCGTGGAGGTAATAATTGACGATATGATCATTTATTCTGCCTCCCA GAGCCTGATAAAAACGGTTAGCGCCATTCGCCATTCAGGCTGCGCAACTG TTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGA AAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCC CAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGGCTGCAGGTC GACGGATCCCCGGGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGA AATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAA GTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGT TGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCAT TAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTA TTTCTTCCAGAATTGCCATGATTTTTTCCCCACGGGAGGCGTCACTGGCT CCCGTGTTGTCGGCAGCTTTGATTCGATAAGCAGCATCGCCTGTTTCAGG CTGTCTATGTGTGACTGTTGAGCTGTAACAAGTTGTCTCAGGTGTTCAAT TTCATGTTCTAGTTGCTTTGTTTTACTGGTTTCACCTGTTCTATTAGGTG TTACATGCTGTTCATCTGTTACATTGTCGATCTGTTCATGGTGAACAGCT TTAAATGCACCAAAAACTCGTAAAAGCTCTGATGTATCTATCTTTTTTAC ACCGTTTTCATCTGTGCATATGGACAGTTTTCCCTTTGATtATCTAACGG TGAACAGTTGTTCTACTTTTGTTTGTTAGTCTTGATGCTTCACTGATAGA TACAAGAGCCATAAGAACCTCAGATCCTTCCGTATTTAGCCAGTATGTTC TCTAGTGTGGTTCGTTGTTTTTGCGTGAGCCATGAGACCGAACCATTGAG ATCATGCTTACTTTGCATGTCACTCAAAAATTTTGCCTCAAAACTGGTGA GCTGAATTTTTGCAGTTAAAGCATCGTGTAGTGTTTTTCTTAGTCCGTTA CGTAGGTAGGAATCTGATGTAATGGTTGTTGGTATTTTGTCACCATTCAT TTTTATCTGGTTGTTCTCAAGTTCGGTTACGAGATCCATTTGTCTATCTA GTTCAACTTGGAAAATCAACGTATCAGTCGGGCGGCCTCGCTTATCAACC ACCAATTTCATATTGCTGTAAGTGTTTAAATCTTTACTTATTGGTTTCAA AACCCATTGGTTAAGCCTTTTAAACTCATGGTAGTTATTTTCAAGCATTA ACATGAACTTAAATTCATCAAGGCTAATCTCTATATTTGCCTTGTGAGTT TTCTTTTGTGTTAGTTCTTTTAATAACCACTCATAAATCCTCATAGAGTA TTTGTTTTCAAAAGACTTAACATGTTCCAGATTATATTTTATGAATTTTT TTAACTGGAAAAGATAAGGCAATATCTCTTCACTAAAAACTAATTCTAAT TTTTCGCTTGAGAACTTGGCATAGTTTGTCCACTGGAAAATCTCAAAGCC TTTAACCAAAGGATTCCTGATTTCCACAGTTCTCGTCATCAGCTCTCTGG TTGCTTTAGCTAATACACCATAAGCATTTTCCCTACTGATGTTCATCATC TGAGCGTATTGGTTATAAGTGAACGATACCGTCCGTTCTTTCCTTGTAGG GTTTTCAATAGTGGGGTTGAGTAGTGCCACACAGCATAAAATTAGCTTGG TTTCATGCTCCGTTAAGTCATAGCGACTAATCGCTAGTTCATTTGCTTTG AAAACAACTAATTCAGACATACATCTCAATTGGTCTAGGTGATTTTAATC ACTATACCAATTGAGATGGGCTAGTCAATGATAATTACTAGTCCTTTTCC TTTGAGTTGTGGGTATCTGTAAATTCTGCTAGACCTTTGCTGGAAAACTT GTAAATTCTGCTAGACCCTCTGTAAATTCCGCTAGACCTTTGTGTGTTTT TTTTGTTTATATTCAAGTGGTTATAATTTATAGAATAAAGAAAGAATAAA AAAAGATAAAAAGAATAGATCCCAGCCCTGTGTATAACTCACTACTTTAG TCAGTTCCGCAGTATTACAAAAGGATGTCGCAAACGCTGTTTGCTCCTCT ACAAAACAGACCTTAAAACCCTAAAGGCTTAAGTAGCACCCTCGCAAGCT CGGGCAAATCGCTGAATATTCCTTTTGTCTCCGACCATCAGGCACCTCAG TCGCTGTCTTTTTCGTGACATTCAGTTCGCTGCGCTCACGGCTCTGGCAG TGAATGGGGGTAAATGGCACTACAGGCGC



Back to Vector page


Back to Homepage