pGEX2T-27k

pGEX2T-27k is a pBR322 derived plasmid that is AmpR and has medium copy number. Expression of TEV protease is induced by IPTG. We recommend replacing tryptone in rich medium by NZ amine A because the latter does not contain lactose which induces the tac promoter. The GST-TEV protease hybrid is expressed as an inclusion body in the presence of high IPTG. Soluble (and active) TEV protease is best obtained at 10 µM IPTG.

- Reference:
Parks, T., K. Leuther, E. Howard, S. Johnston, and W. Dougherty. 1994. Release of proteins and peptides from fusion proteins using a recombinant plant virus proteinase. Anal. Biochem. 216: 413-417.

183-211 Ptac
258-930 GST
930-1671 TEV protease fragment
2070-2930 bla
4011-5093 lacIQ

acgttatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatc ggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgt cgctcaaggcgcactcccgttctggataatgttttttgcgccgacatcat aacggttctggcaaatattctgaaatgagctgttgacaattaatcatcgg ctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaac agtattcatgtcccctatactaggttattggaaaattaagggccttgtgc aacccactcgacttcttttggaatatcttgaagaaaaatatgaagagcat ttgtatgagcgcgatgaaggtgataaatggcgaaacaaaaagtttgaatt gggtttggagtttcccaatcttccttattatattgatggtgatgttaaat taacacagtctatggccatcatacgttatatagctgacaagcacaacatg ttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagc ggttttggatattagatacggtgtttcgagaattgcatatagtaaagact ttgaaactctcaaagttgattttcttagcaagctacctgaaatgctgaaa atgttcgaagatcgtttatgtcataaaacatatttaaatggtgatcatgt aacccatcctgacttcatgttgtatgacgctcttgatgttgttttataca tggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaaaaa cgtattgaagctatcccacaaattgataagtacttgaaatccagcaagta tatagcatggcctttgcagggctggcaagccacgtttggtggtggcgacc atcctccaaaatcggatctggttccgcgtGGATCCttgtttaagggacca cgtgattacaacccgatatcgagcaccatttgtcatttgacgaatgaatc tgatgggcacacaacatcgttgtatggtattggatttggtcccttcatca ttacaaacaagcacttgtttagaagaaataatggaacactgttggtccaa tcactacatggtgtattcaaggtcaagaacaccacgactttgcaacaaca cctcattgatgggagggacatgataattattcgcatgcctaaggatttcc caccatttcctcaaaagctgaaatttagagagccacaaagggaagagcgc atatgtcttgtgacaaccaacttccaaactaagagcatgtctagcatggt gtcagacactagttgcacattcccttcatctgatggcatattctggaagc attggattcaaaccaaggatgggcagtgtggcagtccattagtatcaact agagatgggttcattgttggtatacactcagcatcgaatttcaccaacac aaacaattatttcacaagcgtgccgaaaaacttcatggaattgttgacaa atcaggaggcgcagcagtgggttagtggttggcgattaaatgctgactca gtattgtgggggggccataaagttttcatgagcaaacctgaagagccttt tcagccagttaaggaagcgactcaactcatgaatgaattggtgtactcgC CGGGAATTCATCGTGACTGActgacgatctgcctcgcgcgtttcggtgat gacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttg tctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgg gtgttggcgggtgtcggggcgcagccatgacccagtcacgtagcgatagc ggagtgtataattcttgaagacgaaagggcctcgtgatacgcctattttt ataggttaatgtcatgataataatggtttcttagacgtcaggtggcactt ttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacat tcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaata atattgaaaaaggaagagtatgagtattcaacatttccgtgtcgccctta ttcccttttttgcggcattttgccttcctgtttttgctcacccagaaacg ctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggtta catcgaactggatctcaacagcggtaagatccttgagagttttcgccccg aagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcg gtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcataca ctattctcagaatgacttggttgagtactcaccagtcacagaaaagcatc ttacggatggcatgacagtaagagaattatgcagtgctgccataaccatg agtgataacactgcggccaacttacttctgacaacgatcggaggaccgaa ggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttg atcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgac accacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactgg cgaactacttactctagcttcccggcaacaattaatagactggatggagg cggataaagttgcaggaccacttctgcgctcggcccttccggctggctgg tttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcat tgcagcactggggccagatggtaagccctcccgtatcgtagttatctaca cgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgag ataggtgcctcactgattaagcattggtaactgtcagaccaagtttactc atatatactttagattgatttaaaacttcatttttaatttaaaaggatct aggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgag ttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttc ttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaac caccgctaccagcggtggtttgtttgccggatcaagagctaccaactctt tttccgaaggtaactggcttcagcagagcgcagataccaaatactgtcct tctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgc ctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggc gataagtcgtgtcttaccgggttggactcaagacgatagttaccggataa ggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttgg agcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaa agcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcgg cagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcct ggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcga tttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaa cgcggcctttttacggttcctggccttttgctggccttttgctcacatgt tctttcctgcgttatcccctgattctgtggataaccgtattaccgccttt gagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtc agtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgc atctgtgcggtatttcacaccgcataaattccgacaccatcgaatggtgc aaaacctttcgcggtatggcatgatagcgcccggaagagagtcaattcag ggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccg gtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtt tctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaatta cattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctga ttggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtc gcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtc gatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatc ttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgac caggatgccattgctgtggaagctgcctgcactaatgttccggcgttatt tcttgatgtctctgaccagacacccatcaacagtattattttctcccatg aagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccag caaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcg tctggctggctggcataaatatctcactcgcaatcaaattcagccgatag cggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatg caaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacga tcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcg ttggtgcggatatctcggtagtgggatacgacgataccgaagacagctca tgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggg gcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtga agggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctg gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaat gcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaac gcaattaatgtgagttagctcactcattaggcaccccaggctttacactt tatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttc acacaggaaacagctatgaccatgattacggattcactggccgtcgtttt acaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttg cagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcacc gatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgc ctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatc ttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcacggt tacgatgcgcccatctacaccaacgtaacctatcccattacggtcaatcc gccgtttgttcccacggagaatccgacgggttgttactcgctcacattta atgttgatgaaagctggctacaggaaggccagacgcgaattatttttgat ggcgttggaatt



Back to DNA page
Back to Homepage