pGEX2T

pGEX2Tis a pBR322 derived plasmid that is AmpR and has medium copy number. Expression is induced by IPTG. We recommend replacing tryptone in rich medium by NZ amine A because the latter does not contain lactose which induces the tac promoter.

- Reference:
Smith,D.B. and Johnson,K.S. (1988)
Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase Gene 67: 31-40

183-211 Ptac
258-956 GST
918-935 Thrombin recognition site
1356-2216 bla
3297-4379 lacIQ

acgttatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatc ggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgt cgctcaaggcgcactcccgttctggataatgttttttgcgccgacatcat aacggttctggcaaatattctgaaatgagctgttgacaattaatcatcgg ctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaac agtattcatgtcccctatactaggttattggaaaattaagggccttgtgc aacccactcgacttcttttggaatatcttgaagaaaaatatgaagagcat ttgtatgagcgcgatgaaggtgataaatggcgaaacaaaaagtttgaatt gggtttggagtttcccaatcttccttattatattgatggtgatgttaaat taacacagtctatggccatcatacgttatatagctgacaagcacaacatg ttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagc ggttttggatattagatacggtgtttcgagaattgcatatagtaaagact ttgaaactctcaaagttgattttcttagcaagctacctgaaatgctgaaa atgttcgaagatcgtttatgtcataaaacatatttaaatggtgatcatgt aacccatcctgacttcatgttgtatgacgctcttgatgttgttttataca tggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaaaaa cgtattgaagctatcccacaaattgataagtacttgaaatccagcaagta tatagcatggcctttgcagggctggcaagccacgtttggtggtggcgacc atcctccaaaatcggatctggttccgcgtggatccccgggaattcatcgt gactgactgacgatctgcctcgcgcgtttcggtgatgacggtgaaaacct ctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatg ccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgt cggggcgcagccatgacccagtcacgtagcgatagcggagtgtataattc ttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtca tgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtg cgcggaacccctatttgtttatttttctaaatacattcaaatatgtatcc gctcatgagacaataaccctgataaatgcttcaataatattgaaaaagga agagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcg gcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaa agatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatc tcaacagcggtaagatccttgagagttttcgccccgaagaacgttttcca atgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtgt tgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatg acttggttgagtactcaccagtcacagaaaagcatcttacggatggcatg acagtaagagaattatgcagtgctgccataaccatgagtgataacactgc ggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgctt ttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccg gagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgc agcaatggcaacaacgttgcgcaaactattaactggcgaactacttactc tagcttcccggcaacaattaatagactggatggaggcggataaagttgca ggaccacttctgcgctcggcccttccggctggctggtttattgctgataa atctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggc cagatggtaagccctcccgtatcgtagttatctacacgacggggagtcag gcaactatggatgaacgaaatagacagatcgctgagataggtgcctcact gattaagcattggtaactgtcagaccaagtttactcatatatactttaga ttgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctt tttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactg agcgtcagaccccgtagaaaagatcaaaggatcttcttgagatccttttt ttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcg gtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaac tggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgt agttaggccaccacttcaagaactctgtagcaccgcctacatacctcgct ctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtct taccgggttggactcaagacgatagttaccggataaggcgcagcggtcgg gctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctac accgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcc cgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacag gagagcgcacgagggagcttccagggggaaacgcctggtatctttatagt cctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctc gtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttac ggttcctggccttttgctggccttttgctcacatgttctttcctgcgtta tcccctgattctgtggataaccgtattaccgcctttgagtgagctgatac cgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaag cggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatt tcacaccgcataaattccgacaccatcgaatggtgcaaaacctttcgcgg tatggcatgatagcgcccggaagagagtcaattcagggtggtgaatgtga aaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcag accgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcg ggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcg tggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacc tccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatc tcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaa gcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgc gtcagtgggctgatcattaactatccgctggatgaccaggatgccattgc tgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctg accagacacccatcaacagtattattttctcccatgaagacggtacgcga ctgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgtt agcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggc ataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggc gactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatga gggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgg gcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatc tcggtagtgggatacgacgataccgaagacagctcatgttatatcccgcc gttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtgg accgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctg ttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgca aaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgac aggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgag ttagctcactcattaggcaccccaggctttacactttatgcttccggctc gtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagc tatgaccatgattacggattcactggccgtcgttttacaacgtcgtgact gggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccct ttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttccca acagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcac cagaagcggtgccggaaagctggctggagtgcgatcttcctgaggccgat actgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccat ctacaccaacgtaacctatcccattacggtcaatccgccgtttgttccca cggagaatccgacgggttgttactcgctcacatttaatgttgatgaaagc tggctacaggaaggccagacgcgaattatttttgatggcgttggaatt



Back to DNA page
Back to Homepage