pCS19

- Reference:

Spiess, C., Beil, A., and M. Ehrmann 1999. A temperature-dependent switch from chaperone to protease in a widely conserved heat shock protein. Cell 97: 339- 347


CTCGAGAAATCATAAAAAATTTATTTGCTTTGTGAGCGGATAACAATTAT AATAGATTCAATTGTGAGCGGATAACAATTTCACACAGAATTCATTAAAG AGGAGAAATTAACCATGGGAGGATCCAGATCTCATCACCATCACCATCAC TAAGCTTAATTAGCTGAGCTTGGACTCCTGTTGATAGATCCAGTAATGAC CTCAGAACTCCATCTGGATTTGTTCAGAACGCTCGGTTGCCGCCGGGCGT TTTTTATTGGTGAGAATCCAAGCTAGCTTGGCGAGATTTTCAGGAGCTAA GGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATAT CCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAA TGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGAC CGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTG CCCGCCTGATGAATGCTCATCCGGAATTTCGTATGGCAATGAAAGACGGT GAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGA GCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCC GGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAAC CTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGC CAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGG ACAACTTCTTCGCCCCCGTTTTCACCATGCATGGGCAAATATTATACGCA AGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTCT GTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGC GATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCC TTAAACGCCTGGGGTAATGACTCTCTAGCTTGAGGCATCAAATAAAACGA AAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGT GAACGCTCTCCTGAGTAGGACAAATCCGCCGCTctagattACCGTGCAGT CGATGATAAGCTGTCAAACATGAGAATTGTGCCTAATGAGTGAGCTAACT CACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGT CGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTG CGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACA GCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCC ACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGG CGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGA TATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCC AGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTC ATTCAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGC CTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGC CAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAA CAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTC GCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCA GAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGC AATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGC GTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTT CGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGAGA TTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGG TGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACG CGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCG CGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCT GATAAGAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTC ATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGC GAAAGGTTTTGCACCATTCGATGGTGTCGGAATTTCGGGCAGCGTTGGGT CCTGGCCACGGGTGCGCATGATCTAGAGCTGCCTCGCGCGTTTCGGTGAT GACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTG TCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGG GTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGC GGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGA GTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATA CCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGG TCTGTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGG TTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGG CCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCC ATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAG AGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGG AAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACC TGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGC TGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGT GCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATC GTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCC ACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTT CTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTA TCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCT TGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAA GCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCT TTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATT TTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTA AAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTG ACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTA TTTCGTTCATCCATAGCTGCCTGACTCCCCGTCGTGTAGATAACTACGAT ACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACC CACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGG GCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTAT TAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGC GCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTT GGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATG ATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCG TTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCA CTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGAC TGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGA GTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGA ACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTC AAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCAC CCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCA AAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAA ATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATC AGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAAT AAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGT CTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCA CGAGGCCCTTTCGTCTTCAC



Back to DNA page
Back to Homepage