pBR329

- Reference:

Covarrubias,L. and Bolivar,F. (1982) Gene 17, 79-89


ttccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggat aaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatcc agctgaacggtctggttataggtacattgagcaactgactgaaatgcctc aaaatgttctttacgatgccattgggatatatcaacggtggtatatccag tgatttttttctccattttagcttccttagctcctgatgtttgacagctt atcatcgataagctttaatgcggtagtttatcacagttaaattgctaacg cagtcaggcaccgtgtatgaaatctaacaatgcgctcatcgtcatcctcg gcaccgtcaccctggatgctgtaggcataggcttggttatgccggtactg ccgggcctcttgcgggatatcgtccattccgacagcatcgccagtcacta tggcgtgctgctagcgctatatgcgttgatgcaatttctatgcgcacccg ttctcggagcactgtccgaccgctttggccgccgcccagtcctgctcgct tcgctacttggagccactatcgactacgcgatcatggcgaccacacccgt cctgtggatcctctacgccggacgcatcgtggccggcatcaccggcgcca caggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagat cgggctcgccacttcgggctcatgagcgcttgtttcggcgtgggtatggt ggcaggcccgtggccgggggactgttgggcgccatctccttgcatgcacc attccttgcggcggcggtgctcaacggcctcaacctactactgggctgct tcctaatgcaggagtcgcataagggagagcgtcgaccgatgcccttgaga gccttcaacccagtcagctccttccggtgggcgcggggcatgactatcgt cgccgcacttatgactgtcttctttatcatgcaactcgtaggacaggtgc cggcagcgctctgggtcattttcggcgaggaccgctttcgctggagcgcg acgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgc tcaagccttcgtcactggtcccgccaccaaacgtttcggcgagaagcagg ccattatcgccggcatggcggccgacgcgctgggctacgtcttgctggcg ttcgcgacgcgaggctggatggccttccccattatgattcttctcgcttc cggcggcatcgggatgcccgcgttgcaggccatgctgtccaggcaggtag atgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagc ctaacttcgatcactggaccgctgatcgtcacggcgatttatgccgcctc ggcgagcacatggaacgggttggcatggattgtaggcgccgccctatacc ttgtctgcctccccgcgttgcgtcgcggtgcatggagccgggccacctcc acctgaatggaagccggcggcacctcgctaacggattcaccactccaaga attggagccaatcaattcttgcggagaactgtgaatgcgcaaaccaaccc ttggcagaacatatccatcgcgtccgccatctccagcagccgcacgcggc gcatctcgggccgcgttgctggcgtttttccataggctccgcccccctga cgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacag gactataaagataccaggcgtttccccctggaagctccctcgtgcgctct cctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttc gggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcgg tgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcag cccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggt aagacacgacttatcgccactggcagcagccactggtaacaggattagca gagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaac tacggctacactagaaggacagtatttggtatctgcgctctgctgaagcc agttaccttcggaaaaagagttggtagctcttgatccggcaaacaaacca ccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgc tcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaa aaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatca atctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaat cagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttg cctgactccccgtcgtgtagataactacgatacgggagggcttaccatct ggccccagtgctgcaatgataccgcgagacccacgctcaccggctccaga tttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtc ctgcaactttatccgcctccatccagtctattaattgttgccgggaagct agagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgc tgcaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagct ccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaa aaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggc cgcagtgttatcactcatggttatggcagcactgcataattctcttactg tcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaag tcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtc aacacgggataataccgcgccacatagcagaactttaaaagtgctcatca ttggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttg agatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatc ttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatg ccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactc ttcctttttcaatattatttaagcatttatcagggttattgtctcatgag cggatacatatttgaatgtatttagaaaaataaacaaataggggttccgc gcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatc atgacattaacctataaaaataggcgtatcacgaggccctttcgtctagg catttgagaagcacacggtcacactgcttccggtagtcaataaaccggta aaccagcaatagacataagcggctatttaacgaccctgccctgaaccgac gaccgggtcgaatttgctttcgaatttctgccattcatccgcttattatc acttattcaggcgtagcaccaggcgtttaagggcaccaataactgcctta aaaaaattacgccccgccctgccactcatcgcagtactgttgtaattcat taagcattctgccgacatggaagccatcacaaacggcatgatgaacctga atcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccat ggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaa aactggtgaaactcacccagggattggctgagacgaaaaacatattctca ataaaccctttagggaaataggccaggttttcaccgtaacacgccacatc ttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactcc agagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaaggg tgaacactatcccatatcaccagctcaccgtctttcattgccatacggaa



Back to DNA page


Back to Homepage