pBR328

- Reference:

Soberon X, Covarrubias L, Bolivar F (1980) Gene 9 :287-305 Construction and characterization of new cloning vehicles. IV. Deletion derivatives of pBR322 and pBR325.


ttctcatgtttgacagcttatcatcgataagctttaatgcggtagtttat cacagttaaattgctaacgcagtcaggcaccgtgtatgaaatctaacaat gcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcatagg cttggttatgccggtactgccgggcctcttgcgggatatcgtccattccg acagcatcgccagtcactatggcgtgctgctagcgctatatgcgttgatg caatttctatgcgcacccgttctcggagcactgtccgaccgctttggccg ccgcccagtcctgctcgcttcgctacttggagccactatcgactacgcga tcatggcgaccacacccgtcctgtggatcctctacgccggacgcatcgtg gccggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccga catcaccgatggggaagatcgggctcgccacttcgggctcatgagcgctt gtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggc gccatctccttgcatgcaccattccttgcggcggcggtgctcaacggcct caacctactactgggctgcttcctaatgcaggagtcgcataagggagagc gtcgaccgatgcccttgagagccttcaacccagtcagctccttccggtgg gcgcggggcatgactatcgtcgccgcacttatgactgtcttctttatcat gcaactcgtaggacaggtgccggcagcgctctgggtcattttcggcgagg accgctttcgctggagcgcgacgatgatcggcctgtcgcttgcggtattc ggaatcttgcacgccctcgctcaagccttcgtcactggtcccgccaccaa acgtttcggcgagaagcaggccattatcgccggcatggcggccgacgcgc tgggctacgtcttgctggcgttcgcgacgcgaggctggatggccttcccc attatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggc catgctgtccaggcaggtagatgacgaccatcagggacagcttcaaggat cgctcgcggctcttaccagcctaacttcgatcactggaccgctgatcgtc acggcgatttatgccgcctcggcgagcacatggaacgggttggcatggat tgtaggcgccgccctataccttgtctgcctccccgcgttgcgtcgcggtg catggagccgggccacctcgacctgaatggaagccggcggcacctcgcta acggattcaccactccaagaattggagccaatcaattcttgcggagaact gtgaatgcgcaaaccaacccttggcagaacatatccatcgcgtccgccat ctccagcagccgcacgcggcgcatctcgggccgcgttgctggcgtttttc cataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtca gaggtggcgaaacccgacaggactataaagataccaggcgtttccccctg gaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatac ctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacg ctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtg tgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactat cgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagc cactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagt tcttgaagtggtggcctaactacggctacactagaaggacagtatttggt atctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctc ttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgca agcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatc ttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggat tttggtcatgagattatcaaaaaggatcttcacctagatccttttaaatt aaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtct gacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtct atttcgttcatccatagttgcctgactccccgtcgtgtagataactacga tacgggagggcttaccatctggccccagtgctgcaatgataccgcgagac ccacgctcaccggctccagatttatcagcaataaaccagccagccggaag ggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtcta ttaattgttgccgggaagctagagtaagtagttcgccagttaatagtttg cgcaacgttgttgccattgctgcaggcatcgtggtgtcacgctcgtcgtt tggtatggcttcattcagctccggttcccaacgatcaaggcgagttacat gatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatc gttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagc actgcataattctcttactgtcatgccatccgtaagatgcttttctgtga ctggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccg agttgctcttgcccggcgtcaacacgggataataccgcgccacatagcag aactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactct caaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgca cccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagc aaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacgga aatgttgaatactcatactcttcctttttcaatattattgaagcatttat cagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaa taaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacg tctaagaaaccattattatcatgacattaacctataaaaataggcgtatc acgaggccctttcgtcttcgaataaatacctgtgacggaagatcacttcg cagaataaataaatcctggtgtccctgttgataccgggaagccctgggcc aacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactt tcaccataatgaaataagatcactaccgggcgtattttttgagttatcga gattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatat accaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatt tcagtcagttgctcaatgtacctataaccagaccgttcagctggatatta cggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcc tttattcacattcttgcccgcctgatgaatgctcatccggaattccgtat ggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgtt acaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaa taccacgacgatttccggcagtttctacacatatattcgcaagatgtggc gtgttacggtgaaaacctggcctatttccctaaagggtttattgagaata tgtttttcgtctcagccaatccctgggtgagtttcaccagttttgattta aacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaa atattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttc atcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaatta caacagtactgcgatgagtggcagggcggggcgtaatttttttaaggcag ttattggtgcccttaaacgcctggtgctacgcctgaataagtgataataa gcggatgaatggcagaaattcgaaagcaaattcgacccggtcgtcggttc agggcagggtcgttaaatagccgcttatgtctattgctggtttaccggtt tattgactaccggaagcagtgtgaccgtgtgcttctcaaatgcctgaggc cagtttgctcaggctctccccgtggaggtaataattgacgatatgatcat ttattctgcctcccagagcctgataaaaacggtgaatccgttagcgaggt gccgccggcttccattcaggtcgaggtggcccggctccatgcaccgcgac gcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgcc aacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcag cggtccagtgatcgaagttaggctggtaagagccgcgagcgatccttgaa gctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaac gcgggcatcccgatgccgccggaagcgagaagaatcataatggggaaggc catccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcgg ccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcg ggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgc aagcgac



Back to DNA page
Back to Homepage