pBR327

- Reference:

Soberon X, Covarrubias L, Bolivar F (1980) Gene 9 :287-305 Construction and characterization of new cloning vehicles. IV. Deletion derivatives of pBR322 and pBR325.

Abstract:

In vitro recombinant DNA experiments involving restriction endonuclease fragments derived from the plasmids pBR322 and pBR325 resulted in the construction of two new cloning vehicles. One of these plasmids, designated pBR327, was obtained after an EcoRII partial digestion of pBR322. The plasmid pBR327 confers resistance to tetracycline and ampicillin, contains 3273 base pairs (bp) and therefore is 1089 bp smaller than pBR322. The other newly constructed vector, which has been designated pBR328, confers resistance to chloramphenicol as well as the two former antibiotics. This plasmid contains unique HindIII, BamHI and SalI sites in the tetracycline resistance gene, unique PvuI and PstI sites in the ampicillin resistance gene and unique EcoRI, PvuII and BalI sites in the chloramphenicol resistance gene. The pBR328 plasmid contains approx. 4900 bp.

Sequence:

TTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTAT CACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAAT GCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGG CTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCG ACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATG CAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCG CCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGA TCATGGCGACCACACCCGTCCTGTGGATCCTCTACGCCGGACGCATCGTG GCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGA CATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTT GTTTCGGCGTGGGTATGGTGGCAGGCCCGTGGCCGGGGGACTGTTGGGCG CCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTC AACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCG TCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGG CGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATG CAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGA CCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCG GAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAA CGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCT GGGCTACGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCA TTATGATTCTTCTCGCTTCCGGCGGCATCGGGATGCCCGCGTTGCAGGCC ATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGATC GCTCGCGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCA CGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATT GTAGGCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGC ATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAA CGGATTCACCACTCCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTG TGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCGCCATC TCCAGCAGCCGCACGCGGCGCATCTCGGGCCGCGTTGCTGGCGTTTTTCC ATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAG AGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGG AAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACC TGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGC TGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGT GCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATC GTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCC ACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTT CTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTA TCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCT TGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAA GCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCT TTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATT TTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTA AAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTG ACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTA TTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGAT ACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACC CACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGG GCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTAT TAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGC GCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTT GGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATG ATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCG TTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCA CTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGAC TGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGA GTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGA ACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTC AAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCAC CCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCA AAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAA ATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATC AGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAAT AAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGT CTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCA CGAGGCCCTTTCGTCTTCAAGAA



Back to DNA page
Back to Homepage