pBR325

- Reference:

Prentki P., Karch F., Iida S., Meyer J. Gene (1981) 14: 289-299



aggccatgtttgacagcttatcatcgataagctttaatgcggtagtttat cacagttaaattgctaacgcagtcaggcaccgtgtatgaaatctaacaat gcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcatagg cttggttatgccggtactgccgggcctcttgcgggatatcgtccattccg acagcatcgccagtcactatggcgtgctgctagcgctatatgcgttgatg caatttctatgcgcacccgttctcggagcactgtccgaccgctttggccg ccgcccagtcctgctcgcttcgctacttggagccactatcgactacgcga tcatggcgaccacacccgtcctgtggatcctctacgccggacgcatcgtg gccggcatcaccggcgccacaggtgcggttgctggcgcctatatcgccga catcaccgatggggaagatcgggctcgccacttcgggctcatgagcgctt gtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggc gccatctccttgcatgcaccattccttgcggcggcggtgctcaacggcct caacctactactgggctgcttcctaatgcaggagtcgcataagggagagc gtcgaccgatgcccttgagagccttcaacccagtcagctccttccggtgg gcgcggggcatgactatcgtcgccgcacttatgactgtcttctttatcat gcaactcgtaggacaggtgccggcagcgctctgggtcattttcggcgagg accgctttcgctggagcgcgacgatgatcggcctgtcgcttgcggtattc ggaatcttgcacgccctcgctcaagccttcgtcactggtcccgccaccaa acgtttcggcgagaagcaggccattatcgccggcatggcggccgacgcgc tgggctacgtcttgctggcgttcgcgacgcgaggctggatggccttcccc attatgattcttctcgcttccggcggcatcgggatgcccgcgttgcaggc catgctgtccaggcaggtagatgacgaccatcagggacagcttcaaggat cgctcgcggctcttaccagcctaacttcgatcactggaccgctgatcgtc acggcgatttatgccgcctcggcgagcacatggaacgggttggcatggat tgtaggcgccgccctataccttgtctgcctccccgcgttgcgtcgcggtg catggagccgggccacctcgacctgaatggaagccggcggcacctcgcta acggattcaccactccaagaattggagccaatcaattcttgcggagaact gtgaatgcgcaaaccaacccttggcagaacatatccatcgcgtccgccat ctccagcagccgcacgcggcgcatctcgggcagcgttgggtcctggccac gggtgcgcatgatcgtgctcctgtcgttgaggacccggctaggctggcgg ggttgccttactggttagcagaatgaatcaccgatacgcgagcgaacgtg aagcgactgctgctgcaaaacgtctgcgacctgagcaacaacatgaatgg tcttcggtttccgtgtttcgtaaagtctggaaacgcggaagtcagcgccc tgcaccattatgttccggatctgcatcgcaggatgctgctggctaccctg tggaacacctacatctgtattaacgaagcgctggcattgaccctgagtga tttttctctggtcccgccgcatccataccgccagttgtttaccctcacaa cgttccagtaaccgggcatgttcatcatcagtaacccgtatcgtgagcat cctctctcgtttcatcggtatcattacccccatgaacagaaattccccct tacacggaggcatcaagtgaccaaacaggaaaaaaccgcccttaacatgg cccgctttatcagaagccagacattaacgcttctggagaaactcaacgag ctggacgcggatgaacaggcagacatctgtgaatcgcttcacgaccacgc tgatgagctttaccgcagctgcctcgcgcgtttcggtgatgacggtgaaa acctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcg gatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgg gtgtcggggcgcagccatgacccagtcacgtagcgatagcggagtgtata ctggcttaactatgcggcatcagagcagattgtactgagagtgcaccata tgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcagg cgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggct gcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacag aatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaag gccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccg cccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaa acccgacaggactataaagataccaggcgtttccccctggaagctccctc gtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctt tctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatc tcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccc cccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtc caacccggtaagacacgacttatcgccactggcagcagccactggtaaca ggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtgg tggcctaactacggctacactagaaggacagtatttggtatctgcgctct gctgaagccagttaccttcggaaaaagagttggtagctcttgatccggca aacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagatt acgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggg gtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatga gattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagt tttaaatcaatctaaagtatatatgagtaaacttggtctgacagttacca atgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcat ccatagttgcctgactccccgtcgtgtagataactacgatacgggagggc ttaccatctggccccagtgctgcaatgataccgcgagacccacgctcacc ggctccagatttatcagcaataaaccagccagccggaagggccgagcgca gaagtggtcctgcaactttatccgcctccatccagtctattaattgttgc cgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgt tgccattgctgcaggcatcgtggtgtcacgctcgtcgtttggtatggctt cattcagctccggttcccaacgatcaaggcgagttacatgatcccccatg ttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaag taagttggccgcagtgttatcactcatggttatggcagcactgcataatt ctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtac tcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttg cccggcgtcaacacgggataataccgcgccacatagcagaactttaaaag tgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatctta ccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatc ttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaa ggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaata ctcatactcttcctttttcaatattattgaagcatttatcagggttattg tctcatgagcggatacatatttgaatgtatttagaaaaataaacaaatag gggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaacc attattatcatgacattaacctataaaaataggcgtatcacgaggccctt tcgtcttcgaataaatacctgtgacggaagatcacttcgcagaataaata aatcctggtgtccctgttgataccgggaagccctgggccaacttttggcg aaaatgagacgttgatcggcacgtaagaggttccaactttcaccataatg aaataagatcactaccgggcgtattttttgagttatcgagattttcagga gctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttga tatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttg ctcaatgtacctataaccagaccgttcagctggatattacggccttttta aagaccgtaaagaaaaataagcacaagttttatccggcctttattcacat tcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaag acggtgagctggtgatatgggatagtgttcacccttgttacaccgttttc catgagcaaactgaaacgttttcatcgctctggagtgaataccacgacga tttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtg aaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtc tcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaa tatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgc aaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtt tgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactg cgatgagtggcagggcggggcgtaatttttttaaggcagttattggtgcc cttaaacgcctggtgctacgcctgaataagtgataataagcggatgaatg gcagaaattcgaaagcaaattcgacccggtcgtcggttcagggcagggtc gttaaatagccgcttatgtctattgctggtttaccggtttattgactacc ggaagcagtgtgaccgtgtgcttctcaaatgcctgaggccagtttgctca ggctctccccgtggaggtaataattgacgatatgatcatttattctgcct cccagagcctgataaaaacggtgaatccgttagcgaggtgccgccggctt ccattcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcgggg aggcagacaaggtatagggcggcgcctacaatccatgccaacccgttcca tgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtga tcgaagttaggctggtaagagccgcgagcgatccttgaagctgtccctga tggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatccc gatgccgccggaagcgagaagaatcataatggggaaggccatccagcctc gcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgccatgccg gcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgac gaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgac



Back to DNA page
Back to Homepage