pBR322

- Reference:

Sutcliffe,J.G. 1979. Complete nucleotide sequence of the Escherichia coli plasmid pBR322. Cold Spring Harb. Symp. Quant. Biol. 43, 77-90


TTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTAT CACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAAT GCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGG CTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCG ACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATG CAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCG CCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGA TCATGGCGACCACACCCGTCCTGTGGATCCTCTACGCCGGACGCATCGTG GCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGA CATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTT GTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGC GCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCT CAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGC GTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGG GCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCAT GCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGG ACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTC GGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAA ACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGC TGGGCTACGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCC ATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATGCCCGCGTTGCAGGC CATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGAT CGCTCGCGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTC ACGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGAT TGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTG CATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTA ACGGATTCACCACTCCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACT GTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCGCCAT CTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCAC GGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGG GGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAACGTG AAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGG TCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAAGTCAGCGCCC TGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTG TGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGA TTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAA CGTTCCAGTAACCGGGCATGTTCATCATCAGTAACCCGTATCGTGAGCAT CCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTT ACACGGAGGCATCAGTGACCAAACAGGAAAAAACCGCCCTTAACATGGCC CGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCT GGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTG ATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAAC CTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGA TGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGT GTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACT GGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATG CGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCG CTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGC GGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAA TCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGC CAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCC CCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAAC CCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGT GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTC TCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTC AGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCC CGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA ACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGG ATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTG GCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGC TGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAA CAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTAC GCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGT CTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGA TTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTT TAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAAT GCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCC ATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTT ACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGG CTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGA AGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCG GGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTG CCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCA TTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTT GTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTA AGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCT CTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTC AACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCC CGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTG CTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACC GCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTT CAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGG CAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACT CATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTC TCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGG GTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCAT TATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTC GTCTTCAAGAA



Back to DNA page
Back to Homepage