pBADtreF expresses treF from pBAD22 under control of the araBAD promoter. treF expresses cytoplasmic trehalase F from E. coli

Reference:
Horlacher, R., Uhland, K., Klein, W., Ehrmann, M. and Boos, W. (1996) J. Bacteriol. 178, 6250-6257

comments:
treF as BamHI (filled) - NcoI frg. in pBAD22 cut EcoRI (filled), NcoI
treF ATG at 1323
treF TAA at 2970


ATcgaTGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAAC CCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATG ACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAAC TCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAG TTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGG TGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAG CTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGA CGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGT CTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCC ATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAA TTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTT GCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGC GCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTT AAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGAT ACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGC GGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATT TTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCA TTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATC GGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAG GGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAG AAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTT TACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCAT TCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTG TCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACA CTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTG ACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGG CTAGCaggaggAATTGATCCTTatgctcaatcagaaaattcaaaacccta atccagacgaactgatgatcgaagtcgatctctgctatgagctggacccg tatgaattaaaactggatgagatgatcgaggcagaaccggaacccgagat gattgaagggctgcctgcctctgatgcgctgacgcctgccgatcgctatc tcgaactgttcgagcatgttcagtcggcgaaaattttccccgacagtaaa acctttcccgactgcgcacctaaaatggacccgctggatatcttaatccg ctaccgtaaagtgcgccgtcatcgtgattttgacttgcgcaagtttgttg aaaaccacttctggctgccggaggtctactccagcgagtatgtatcggac ccgcaaaattccctgaaagagcatatcgaccagctgtggccggtgctaac ccgcgaaccacaggatcacattccgtggtcttctctgctggcgctgccgc agtcatatattgtcccgggcggccgttttagcgaaacctactattgggat tcctatttcaccatgctggggctggcggaaagtggtcgggaagatttgct gaaatgcatggccgataacttcgcctggatgatcgaaaactacggtcaca tccccaacggcaaccgcacctattatttgagccgctcgcaaccaccggtt tttgcgctgatggtggagttgtttgaagaagatggtgtacgcggtgcgcg ccgctatctcgaccaccttaaaatggaatatgccttctggatggacggtg cagaatcgttaatccctaatcaggcctatcgccatgttgtgcggatgccg gacggatcgctgctcaaccgttactgggacgatcgcgacacgccgcgtga cgaatcctggcttgaggacgttgaaaccgcgaaacattctggtcgcccgc ccaacgaggtgtaccgcgatttacgcgcgggggcggcctccggttgggat tactcttcccgttggctgcgtgatactggtcgtctggcgagcattcgtac cacccagttcatccccatcgatctgaatgccttcctgtttaaactggaga gcgccatcgccaacatctcggcgctgaaaggcgagaaagagacagaagca ctgttccgccagaaagccagtgcccgtcgcgatgcggtaaaccgttacct ctgggatgatgaaaacggcatctaccgcgattacgactggcgacgcgaac aactggcgctgttttccgctgccgccattgtgccactctatgtcggtatg gcgaaccatgaacaggccgatcgtctggcaaacgccgtgcgcagtcggtt actgacacctggcgggattctggcaagcgagtacgaaaccggtgaacagt gggataaacccaacggctgggcaccgttacaatggatggcgattcaggga tttaaaatgtacggcgatgaccttctgggtgatgaaatcgcgcgaagctg gctgaagacggtgaatcagttctatctggaacagcacaaactgatcgaaa aataccatattgccgatggtgttccccgcgaaggcggcggtggcgagtat ccgttgcaggatgggtttggctggactaacggtgtggtacgccgtttaat tggtttgtacggcgaaccataaTATTTTTACAGCCAGCCGCTAACTTCCT GCTGGCTGTAAAATTATCCTCTTCAGGAGGAGATATTTAACATCATTGCC GCCTGGGTGCGATTTTTCACTTCCAGACGGCGATACAGGGATTCCAGATG CGCTTTTACCGTTCCGGTACTGATATTCAGCGCTCTGCCGATCTCCTTAT TTGATTCGCCCGCCGCTAACATGGTTAAAATCTCCCGCTGGCGGGCGCTT AACGATTTGAGATCTTTAATGTCCTTTTCCGGCGTCGTCCGCCAGTCTCC AGGCAGAAACATCATCCCCATCGCCGCACTATTTACCGCCAACGCAAATG TCTCGACGGTTGAATCACGAGGCACAATGGCCAGCACATTAAAATGGATA ACTTCCTGTAACCACCGTTTATTGCAATCCGTCGCCGTAATTAACACCTT AACCTCAGGAAATTGCACCACGGTTTTTTGCAGCAACCAGTAGCAAAACT CACCATCCTGATCGCCATCGAGCATAACTAAGGCTTCAGGGTAACTTTCC AGCTTTTGCCATAACTCGTCTGCCTGACTGGCCCCCTGAATACTCACTCC TGGAATACGCTGCTGTAAACTGATTTTCATTCCATGAATAAATATTGACT GCCTGTCAAACATGACTATTTGCATAACTGAATCTCCACCTGAATACGTT AAAAAGACTTAAGTAGTGGAAGGGTATTACCCGCGAGAAAAAATAAGAAT Tccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcac ccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctg gagtgaataccacgacgatttccggcagtttctacacatatattcgcaag atgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttatt gagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttt tgatttaaacgtggccaatatggacaacttcttcgcccccgttttcacca tggTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTctgt tttggcggatgagagaagattttcagcctgatacagattaaatcagaacg cagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtgg tcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgat ggtagtgtggggtcccccatgcgagagtagggaactgccaggcatcaaat aaaacgaaaggctcagtgcaaagactgggcctttcgttttatctgttgtt tgtcggtgaacgctctcctgagtaggacaaatccgccgggagcggatttg aacgttgcgaagcaacggcccggagggtggcgggcaggacgcccgccata aactgccaggcatcaaattaagcagaaggccatcctgacggatggccttt ttgcgtttctacaaactcttTGTTTatttttctaaatacattcaaatatg tatccgctcatgagacaataaccctgataaatgcttcaataatattgaaa aaggaagagtatgagtattcaacatttccgtgtcgcccttattccctttt ttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaa gtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaact ggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgtt ttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcc cgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctca gaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatg gcatgacagtaagagaattatgcagtgctgccataaccatgagtgataac actgcggccaacttacttctgacaacgatcggaggaccgaaggagctaac cgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttggg aaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatg cctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactact tactctagcttcccggcaacaattaatagactggatggaggcggataaag ttgcaggaccacttctgcgctcggcccttccggctggctggtttattgct gataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcact ggggccagatggtaagccctcccgtatcgtagttatctacacgacgggga gtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcc tcactgattaagcattggtaactgtcagaccaagtttactcatatatact ttagattgaTTTACGCGccctgtagcggcgcattaagcgcggcgggtgtg gtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgc tcctttcgctttcttcccttcctttctcgccacgttcgccggctttcccc gtcaagctctaaatcgggggctccctttagggttccgatttagtgcttta cggcacctcgaccccaaaaaacttgatttgggtgatggttcacgtagtgg gccatcgccctgatagacggtttttcgccctttgacgttggagtccacgt tctttaatagtggactcttgttccaaactggaacaacactcaaccctatc tcgggctattcttttgatttataagggattttgccgatttcggcctattg gttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaa tattaacgtttacaaTTTAAAAggatctaggtgaagatcctttttgataa tctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcag accccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgc gtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttg tttgccggatcaagagctaccaactctttttccgaaggtaactggcttca gcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggc caccacttcaagaactctgtagcaccgcctacatacctcgctctgctaat cctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggt tggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacg gggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaact gagatacctacagcgtgagcattgagaaagcgccacgcttcccgaaggga gaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgc acgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgg gtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagggg ggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctg gccttttgctggccttttgctcacatgttctttcctgcgttatcccctga ttctgtggataaccgtattaccgcctttgagtgagctgataccgctcgcc gcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagag cgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccg catatggtgcactctcagtacaatctgctctgatgccgcatagttaagcc agtatacactccgctatcgctacgtgactgggtcatggctgcgccccgac acccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggca tccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagag gttttcaccgtcatcaccgaaacgcgcgaggCAGCAAggagatggcgccc aacagtcccccggccacggggcctgccaccatacccacgccgaaacaagc gctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcgg cgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacg atgcgtccggcgtagaGgatctAATTCTCATGTTTGACAGCTTATC



Back to DNA page
Back to Homepage