pBAD24

- Reference: Guzman, L.-M., Belin, D., Carson, M., and Beckwith, J. (1995) J. Bacteriol. 177, 4121-4130

bp 96-974 araC
1250..1277 pBAD promoter
1300-1366 polylinker
1306..1311 optimized RBS
1317..1319 Kozak sequence
1367-1792 rrnB terminator
1885-2748 bla
2784-3242 M13 ori
3248-3945 pBR ori

atcgatgcataatgtgcctgtcaaatggacgaagcagggattctgcaaac cctatgctactccgtcaagccgtcaattgtctgattcgttaccaattatg acaacttgacggctacatcattcactttttcttcacaaccggcacggaac tcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagag ttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccggg tggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccag cttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcga cggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgt ctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatcc atcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaa ttgctcaagcagatttatcgccagcagctccgaatagcgcccttcccctt gcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgc gcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagtt aagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgat accattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggc gggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatt tttcaccaccccctgaccgcgaatggtgagattgagaatataacctttca ttcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatc ggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcag gggatcattttgcgcttcagccatacttttcatactcccgccattcagag aagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttt tactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcat tctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtg tctataatcacggcagaaaagtccacattgattatttgcacggcgtcaca ctttgctatgccatagcatttttatccataagattagcggatcctacctg acgctttttatcgcaactctctactgtttctccatacccgtttttttggg ctagcaggaggaattcaccatggtacccggggatcctctagagtcgacct gcaggcatgcaagcttggctgttttggcggatgagagaagattttcagcc tgatacagattaaatcagaacgcagaagcggtctgataaaacagaatttg cctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcaga agtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagag tagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactg ggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtagga caaatccgccgggagcggatttgaacgttgcgaagcaacggcccggaggg tggcgggcaggacgcccgccataaactgccaggcatcaaattaagcagaa ggccatcctgacggatggcctttttgcgtttctacaaactcttttgttta tttttctaaatacattcaaatatgtatccgctcatgagacaataaccctg ataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatt tccgtgtcgcccttattcccttttttgcggcattttgccttcctgttttt gctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttggg tgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttg agagttttcgccccgaagaacgttttccaatgatgagcacttttaaagtt ctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaact cggtcgccgcatacactattctcagaatgacttggttgagtactcaccag tcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagt gctgccataaccatgagtgataacactgcggccaacttacttctgacaac gatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatc atgtaactcgccttgatcgttgggaaccggagctgaatgaagccatacca aacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcg caaactattaactggcgaactacttactctagcttcccggcaacaattaa tagactggatggaggcggataaagttgcaggaccacttctgcgctcggcc cttccggctggctggtttattgctgataaatctggagccggtgagcgtgg gtctcgcggtatcattgcagcactggggccagatggtaagccctcccgta tcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaat agacagatcgctgagataggtgcctcactgattaagcattggtaactgtc agaccaagtttactcatatatactttagattgatttacgcgccctgtagc ggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctac acttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttc tcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccct ttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttga tttgggtgatggttcacgtagtgggccatcgccctgatagacggtttttc gccctttgacgttggagtccacgttctttaatagtggactcttgttccaa acttgaacaacactcaaccctatctcgggctattcttttgatttataagg gattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaa aatttaacgcgaattttaacaaaatattaacgtttacaatttaaaaggat ctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtg agttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatct tcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaa accaccgctaccagcggtggtttgtttgccggatcaagagctaccaactc tttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtc cttctagtgtagccgtagttaggccaccacttcaagaactctgtagcacc gcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtg gcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggat aaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagctt ggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgag aaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagc ggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgc ctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtc gatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagc aacgcggcctttttacggttcctggccttttgctggccttttgctcacat gttctttcctgcgttatcccctgattctgtggataaccgtattaccgcct ttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgag tcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttac gcatctgtgcggtatttcacaccgcatagggtcatggctgcgccccgaca cccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcat ccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagagg ttttcaccgtcatcaccgaaacgcgcgaggcagcaaggagatggcgccca acagtcccccggccacggggcctgccaccatacccacgccgaaacaagcg ctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggc gatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacga tgcgtccggcgtagaggatctgctcatgtttgacagcttatc



Back to DNA page


Back to Homepage