pBAD18

- Reference: Guzman, L.-M., Belin, D., Carson, M., and Beckwith, J. (1995) J. Bacteriol. 177, 4121-4130

bp 96-974 araC
96..974 araC
1250-1277 pBAD promoter
1300-1362 polylinker
1363..1788 rrnB terminator
1843..1849 bla promoter
1881..2744 bla
2780..3238 M13 ori
3244..3941 pBR ori

atcgatgcataatgtgcctgtcaaatggacgaagcagggattctgcaaac cctatgctactccgtcaagccgtcaattgtctgattcgttaccaattatg acaacttgacggctacatcattcactttttcttcacaaccggcacggaac tcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagag ttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccggg tggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccag cttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcga cggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgt ctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatcc atcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaa ttgctcaagcagatttatcgccagcagctccgaatagcgcccttcccctt gcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgc gcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagtt aagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgat accattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggc gggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatt tttcaccaccccctgaccgcgaatggtgagattgagaatataacctttca ttcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatc ggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcag gggatcattttgcgcttcagccatacttttcatactcccgccattcagag aagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttt tactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcat tctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtg tctataatcacggcagaaaagtccacattgattatttgcacggcgtcaca ctttgctatgccatagcatttttatccataagattagcggatcctacctg acgctttttatcgcaactctctactgtttctccatacccgtttttttggg ctagcgaattcgagctcggtacccggggatcctctagagtcgacctgcag gcatgcaagcttggctgttttggcggatgagagaagattttcagcctgat acagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctg gcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtg aaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagg gaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcc tttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaa tccgccgggagcggatttgaacgttgcgaagcaacggcccggagggtggc gggcaggacgcccgccataaactgccaggcatcaaattaagcagaaggcc atcctgacggatggcctttttgcgtttctacaaactcttttgtttatttt tctaaatacattcaaatatgtatccgctcatgagacaataaccctgataa atgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccg tgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctc acccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgca cgagtgggttacatcgaactggatctcaacagcggtaagatccttgagag ttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgc tatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggt cgccgcatacactattctcagaatgacttggttgagtactcaccagtcac agaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctg ccataaccatgagtgataacactgcggccaacttacttctgacaacgatc ggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgt aactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacg acgagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaa ctattaactggcgaactacttactctagcttcccggcaacaattaataga ctggatggaggcggataaagttgcaggaccacttctgcgctcggcccttc cggctggctggtttattgctgataaatctggagccggtgagcgtgggtct cgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgt agttatctacacgacggggagtcaggcaactatggatgaacgaaatagac agatcgctgagataggtgcctcactgattaagcattggtaactgtcagac caagtttactcatatatactttagattgatttacgcgccctgtagcggcg cattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacactt gccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgc cacgttcgccggctttccccgtcaagctctaaatcgggggctccctttag ggttccgatttagtgctttacggcacctcgaccccaaaaaacttgatttg ggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccc tttgacgttggagtccacgttctttaatagtggactcttgttccaaactt gaacaacactcaaccctatctcgggctattcttttgatttataagggatt ttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatt taacgcgaattttaacaaaatattaacgtttacaatttaaaaggatctag gtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagtt ttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttctt gagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaacca ccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttt tccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttc tagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcct acatacctcgctctgctaatcctgttaccagtggctgctgccagtggcga taagtcgtgtcttaccgggttggactcaagacgatagttaccggataagg cgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggag cgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaag cgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggca gggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctgg tatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatt tttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacg cggcctttttacggttcctggccttttgctggccttttgctcacatgttc tttcctgcgttatcccctgattctgtggataaccgtattaccgcctttga gtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcag tgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcat ctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctc tgatgccgcatagttaagccagtatacactccgctatcgctacgtgactg ggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgac gggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctcc gggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgag gcagcaaggagatggcgcccaacagtcccccggccacggggcctgccacc atacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatc ttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtgg cgccggtgatgccggccacgatgcgtccggcgtagaggatctgctcatgt ttgacagcttatc



Back to DNA page


Back to Homepage