pACYC177

- Reference:

Chang, A. C. Y. and Cohen, S. N. 1978. J. Bacteriol. 134: 1141-1156


gttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaa tgacttggttgagtactcaccagtcacagaaaagcatcttacggatggca tgacagtaagagaattatgcagtgctgccataaccatgagtgataacact gcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgc ttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaac cggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcct gcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttac tctagcttcccggcaacaattaatagactggatggaggcggataaagttg caggaccacttctgcgctcggcccttccggctggctggtttattgctgat aaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggg gccagatggtaagccctcccgtatcgtagttatctacacgacggggagtc aggcaactatggatgaacgaaatagacagatcgctgagataggtgcctca ctgattaagcattggtaactgtcagaccaagtttactcatatatacttta gattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcc tttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccac tgagcgtcagaccccttaataagatgatcttcttgagatcgttttggtct gcgcgtaatctcttgctctgaaaacgaaaaaaccgccttgcagggcggtt tttcgaaggttctctgagctaccaactctttgaaccgaggtaactggctt ggaggagcgcagtcaccaaaacttgtcctttcagtttagccttaaccggc gcatgacttcaagactaactcctctaaatcaattaccagtggctgctgcc agtggtgcttttgcatgtctttccgggttggactcaagacgatagttacc ggataaggcgcagcggtcggactgaacggggggttcgtgcatacagtcca gcttggagcgaactgcctacccggaactgagtgtcaggcgtggaatgaga caaacgcggccataacagcggaatgacaccggtaaaccgaaaggcaggaa caggagagcgcacgagggagccgccagggggaaacgcctggtatctttat agtcctgtcgggtttcgccaccactgatttgagcgtcagatttcgtgatg cttgtcaggggggcggagcctatggaaaaacggctttgccgcggccctct cacttccctgttaagtatcttcctggcatcttccaggaaatctccgcccc gttcgtaagccatttccgctcgccgcagtcgaacgaccgagcgtagcgag tcagtgagcgaggaagcggaatatatcctgtatcacatattctgctgacg caccggtgcagccttttttctcctgccacatgaagcacttcactgacacc ctcatcagtgccaacatagtaagccagtatacactccgctagcgctgagg tctgcctcgtgaagaaggtgttgctgactcataccaggcctgaatcgccc catcatccagccagaaagtgagggagccacggttgatgagagctttgttg taggtggaccagttggtgattttgaacttttgctttgccacggaacggtc tgcgttgtcgggaagatgcgtgatctgatccttcaactcagcaaaagttc gatttattcaacaaagccacgttgtgtctcaaaatctctgatgttacatt gcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacat aaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtctt gctcgaggccgcgattaaattccaacatggatgctgatttatatgggtat aaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgatt gtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggta gcgttgccaatgatgttacagatgagatggtcagactaaactggctgacg gaatttatgcctcttccgaccatcaagcattttatccgtactcctgatga tgcatggttactcaccactgcgatccccgggaaaacagcattccaggtat tagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtg ttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacag cgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtt tggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaa caagtctggaaagaaatgcataagcttttgccattctcaccggattcagt cgtcactcatggtgatttctcacttgataaccttatttttgacgagggga aattaataggttgtattgatgttggacgagtcggaatcgcagaccgatac caggatcttgccatcctatggaactgcctcggtgagttttctccttcatt acagaaacggctttttcaaaaatatggtattgataatcctgatatgaata aattgcagtttcatttgatgctcgatgagtttttctaatcagaattggtt aattggttgtaacactggcagagcattacgctgacttgacgggacggcgg ctttgttgaataaatcgaacttttgctgagttgaaggatcagatcacgca tcttcccgacaacgcagaccgttccgtggcaaagcaaaagttcaaaatca ccaactggtccacctacaacaaagctctcatcaaccgtggctccctcact ttctggctggatgatggggcgattcaggcctggtatgagtcagcaacacc ttcttcacgaggcagacctcagcgctcaaagatgcaggggtaaaagctaa ccgcatctttaccgacaaggcatccggcagttcaacagatcgggaagggc tggatttgctgaggatgaaggtggaggaaggtgatgtcattctggtgaag aagctcgaccgtcttggccgcgacaccgccgacatgatccaactgataaa agagtttgatgctcagggtgtagcggttcggtttattgacgacgggatca gtaccgacggtgatatggggcaaatggtggtcaccatcctgtcggctgtg gcacaggctgaacgccggaggatcctagagcgcacgaatgagggccgaca ggaagcaaagctgaaaggaatcaaatttggccgcaggcgtaccgtggaca ggaacgtcgtgctgacgcttcatcagaagggcactggtgcaacggaaatt gctcatcagctcagtattgcccgctccacggtttataaaattcttgaaga cgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataat aatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaa cccctatttgtttatttttctaaatacattcaaatatgtatccgctcatg agacaataaccctgataaatgcttcaataatattgaaaaaggaagagtat gagtattcaacatttccgtgtcgcccttattcccttttttgcggcatttt gccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgct gaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacag cggtaagatccttgagagttttcgccccgaagaacgttttccaatgatga gcacttttaaagttctgctatgtggcgcggtattatcccgt



Back to DNA page
Back to Homepage