TnphoA

Reference:

Manoil C, Beckwith J. 1985. TnphoA: a transposon probe for protein export signals. Proc Natl Acad Sci U S A. 1985 82:8129-8133.

Nucleotide sequence of TnphoA

ctgactcttatacacaagtagcgtcctggacggaacctttcccgttttgc CCTGTTCTGGAAAACCGGGCTGCTCAGGGCGATATTACTGCACCCGGCGG TGCTCGCCGTTTAACGGGTGATCAGACTGCCGCTCTGCGTGATTCTCTTA GCGATAAACCTGCAAAAAATATTATTTTGCTGATTGGCGATGGGATGGGG GACTCGGAAATTACTGCCGCACGTAATTATGCCGAAGGTGCGGGCGGCTT TTTTAAAGGTATAGATGCCTTACCGCTTACCGGGCAATACACTCACTATG CGCTGAATAAAAAAACCGGCAAACCCGACTACGTCACCGACTCGGCTGCA TCAGCAACCGCCTGGTCAACCGGTGTCAAAACCTATAACGGCGCGCTGGG CGTCGATATTCACGAAAAAGATCACCCAACGATTCTGGAAATGGCAAAAG CCGCAGGTCTGgCGACCGGTAACGTTTCTACCGCAGAGTTGCAGGATGCC ACGCCCGCTGCGCTGGTGGCACATGTGACCTCGCGCAAATGCTACGGTCC GAGCGCGACCAGTGAAAAATGTCCGGGTAACGCTCTGGAAAAAGGCGGAA AAGGATCGATTACCGAACAGCTGCTTAACGCTCGTGCCGACGTTACGCTT GGCGGCGGCGCAAAAACCTTTGCTGAAACGGCAACCGCTGGTGAATGGCA GGGAAAAACGCTGCTGGAACAGGCACAGGCGCGTGGTTATCAGTTGGTGA GCGATGCTGCCTCACTGAATTCGGTGACGGAAGCGAATCAGCAAAAACCC CTGCTTGGCCTGTTTGCTGACGGCAATATGCCAGTGCGCTGGCTAGGACC GAAAGCAACGTACCATGGCAATATCGATAAGCCCGCAGTCACCTGTACGC CAAATCCGCAACGTAATGACAGTGTACCAACCCTGGCGCAGATGACCGAC AAAGCCATTGAATTGTTGAGTAAAAATGAGAAAGGCTTTTTCCTGCAAGT TGAAGGTGCGTCAATCGATAAACAGGATCATGCTGCGAATCCTTGTGGGC AAATTGGCGAGACGGTCGATCTCGATGAAGCCGTACAACGGGCGCTGGAA TTCGCTAAAAAGGAGGGTAACACGCTGGTCATAGTCACCGCTGATCACGC CCACGCCAGCCAGATTGTTGCGCCGGATACCAAAGCTCCGGGCCTCACCC AGGCGCTAAATACCAAAGATGGCGCAGTGATGGTGATGAGTTACGGGAAC TCCGAAGAGGATTCACAAGAACATACCGGCAGTCAGTTGCGTATTGCGGC GTATGGCCCGCATGCCGCCAATGTTGTTGGACTGACCGACCAGACCGATC TCTTCTACACCATGAAAGCCGCTCTGGGGCTGAAATAAAACCGCGCCCgg cagtgaattttcgctgccgggtggtttttttgctgttagcaaccagactt aatggcagatcacgggcgcatacgctcatggttaaaacatgaagagggat ggtgctatgaaaataacattactggttaccttgcttttcggtctggtttt tttaaccaccgtcggcgctgccgagagaactttaaccccacaacaacagc gtatgacctcctgtaatcagcaggcgacggcgcaggcgttgaaaggggat gctcgtaagacctacatgagtgattgcctgaagaacagcaagtctgcgcc tggcgaaaaaagtttgacgccacagcagcaaaagatgcgcgaatgcaata atcaagcaacacaacaatctctgaaaggtgatgatcgtaataagtttatg agtgcctgcctcaagaaagccgcctgatacctgatagtgctaacgggtga gctacgaaaatggctcacccgaaatatcatacttctgcctttagctccgt ctctataatttgggaaaattgtttctgaatgttcccaaaaataatgaatg atgaaaactttttcaaaaaagcggcggcgcacggggaggaacctccttta actcctcaaaacgaacatcagcggtccgggctgcgcttcgcccgtcgcgt cagactaccccgtgcggttggcctggctggcatgttcttaccgattgctt caacgctggtttcacacccgccgccgggctggtggtggctggtgttggtc ggctgggcgttcgtctggccgcatttagcctggcagatagcgagcagggc cgtcgatccgcttagccgggaaatttacaacttaaaaaccgatgcagtat tagcgggaatgtgggtaggcgtaatgggcgtaaacgtgctgccttccacc gcgatgttgatgattatgtgtctgaatttgatgggggcaggcggcccccg tctgtttgtcgcgggtctggtgttgatggtggtttcctgccttgtcaccc tcGAGGCCACCACATTCCGCACCGTAGGATTACTGCATCAGGAGTGGTGG ATGCGCCCGGATGACCCTGCCGATGCGGATGAAAAGGAGAGTGGCAAATG GCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATGAGCA ACGTGATTGCGGTCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAG GACAGGCTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACG CAAGGACGTAGAGTCTGGGTTGTATCTGATCGACCATCTGAAGAACCAAC CGGAGTTGGGTGGCTATCAGATCAGCATTCCGCAAAAGGGCGTGGTGGAT AAACGCGGTAAACGTAAAAATCGACCAGCCCGCAAGGCGAGCTTGAGCCT GCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAACGCGG TGCTGGCCGAGGAGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGG TTGTTGCTGACCGGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGT CATCGACATTTATACCCATCGCTGGCGGATCGAGGAGTTCCATAAGGCAT GGAAAACCGGAGCAGGAGCCGAGAGGCAACGCATGGAGGAGCCGGATAAT CTGGAGCGGATGGTCTCGATCCTCTCGTTTGTTGCGGTCAGGCTGTTACA GCTCAGAGAAAGCTTCACGCTGCCGCAAGCACTCAGGGCGCAAGGGCTGC TAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACC CCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCG CAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGAC TGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCC CTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGC CGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGA TGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCC GGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAA TCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCG GTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGA CGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAG CTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGC GAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAA AGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGT ACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCA TCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGC CCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAAT ATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCT GGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTG CTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGT ATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGA GTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCC CAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGT TGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGC GGGGATCTCATGCTGGAGTTCTTCGCCCACCCCGGGCTCGATCCCCTCGC GAGTTGGTTCAGCTGCTGCCTGAGGCTGGACGACCTCGCGGAGTTCTACC GGCAGTGCAAATCCGTCGGCATCCAGGAAACCAGCAGCGGCTATCCGCGC ATCCATGCCCCCGAACTGCAGGAGTGGGGAGGCACGATGGCCGCTTTGGT Cgacccggacgggacgctcctgcgcctgatacagaacgaattgcttgcag ggcatctcatgagtgtgtcttcccgttttccgcctgaggtcactgcgtgg atggagcgctggcgcctgctgcgcgacggcgagctgctcaccacccactc gagctggatacttcccgtccgccagggggacatgccggcgatgctgaagg tcgcgcgcattcccgatgaagaggccggttaccgcctgttgacctggtgg gacgggcagggcgccgcccgactcttcgcctcggcggcgggcgctctgct catggagcgcgcgtccggggccggggaccttgcacagatagcgtggtccg gccaggacgacgaggcttgcaggatcctctgcgacaccgccgctcgtctg cacgcgccgcggtccggaccgccgccccatctccatccgctacaggaatg gttccagccgcttttccggttggccgctgagcacgcggcacttgcgcccg ccgccagcgtagcgcgccaacttctggcggcgccgcgcgaggtgtgcccg ctccacggcgacctgcaccacgagaacgtgctcgacttcggcgaccgcgg ctggctggccatcgacccgcacggactgctcggcgagcgcaccttcgact atgccaacatcttcacgaatcccgatctcagcgaccccggtcgcccgctt gcgatcctggccgggcaggctggaggctcgactcagcattgtggtcgcga cgaccgggtttgagcccgaacggcttcttcgctggatcattgcatggacg ggcttgtcggcagcctggttcatcggcgacggcgacggcgagggcgaggg cgctgcgattgatctggccgtaaacgccatggcacgccggttgcttgact agcgcggtcaccgatctcacctggtcgtcgagctaggtcaggccgtgtcg ggcgtgatccgctggaagtcgttgcgggccacacccgccgcctcgaagcc ctgcaccaggccggcatcgtggtgtgcgtggccgagagggactatggaag gtgccggacgatctgcccgagcagggccgccgctatgacgcccagcgtct tggtggcgtgacggtggagctgaaatcgcacctgcccatcgagcggcagg cccgcgtgatcggtgccacctggcttgaccagcagttgatcgacggtggc tcgggcttgggcgacctgggctttagcagtgaggccaagtaggcgataca gcagcgcgcggacttcctggccgaacagggactggccgagcggcgcgggc agcgcgtgatcctcaccggaatctgctcggcagcagcgggctcgggaact ggcgcaggccgcgaaggacattgccgccgataccggcctggagcatcgcc ccgtggccgacggccagcgcgttgccggcgtctaccggcgccccgtcatg ctcgccagcgggcgaaatgggatgcttgatgacgccaaggggtccagcct cgtgcggtggaagcccatcgaacagcggcttggggagcagctcgccgcga cggtgcgcggtggcggcgtgtcttgggagattggacgacagcgtgggccg gcccctgtctcttgaTCAGATCTTGATCCCCTGCGCCATCAGATCCTTGG CGGCAAGAAAGCCATCCAGTTTACTTTGCAGGGCTTCCCAACCTTCCCAG AGGGCGCCCCAGCTGGCAATTCCGGTTCGCTTGCTGTCCATAAAACCGCC CAGTCTAGCTATCGCCATGTAAGCCCACTGCAAGCTACCTGCTTTCTCTT TGCGCTTGCGTTTTCCCTTGTCCAGATAGCCCAGTAGCTGACATTCATCC GGGGTCAGCACCGTTTCTGCGGACTGGCTTTCTACGTGTTCCGCTTCCTT TAGCAGCCCTTGCGCCCTGAGTGCTTGCGGCAGCGTGAAGCTTTCTCTGA GCTGTAACAGCCTGACCGCAACAAACGAGAGGATCGAGACCATCCGCTCC AGATTATCCGGCTCCTCCATGCGTTGCCTCTCGGCTCCTGCTCCGGTTTT CCATGCCTTATGGAACTCCTCGATCCGCCAGCGATGGGTATAAATGTCGA TGACGCGCAAGGCTTGGGCTAGCGACTCGACCGGTTCGCCGGTCAGCAAC AACCATTTCAACGGGGTCTCACCCTTGGGCGGGTTAATCTCCTCGGCCAG CACCGCGTTGAGCGTGATATTCCCCTGTTTTAGCGTGATGCGCCCACTGC GCAGGCTCAAGCTCGCCTTGCGGGCTGGTCGATTTTTACGTTTACCGCGT TTATCCACCACGCCCTTTTGCGGAATGCTGATCTGATAGCCACCCAACTC CGGTTGGTTCTTCAGATGGTCGATCAGATACAACCCAGACTCTACGTCCT TGCGTGGGTGCTTGGAGCGCACCACGAAGCGCTCGTTATGCGCCAGCCTG TCCTGCAGATAAGCATGAATATCGGCTTCGCGGTCACAGACCGCAATCAC GTTGCTCATCATGCTGCCCATGCGTAACCGGCTAGTTGCGGCCGCTGCCA GCCATTTGCCACTCTCCTTTTCATCCGCATCGGCAGGGTCATCCGGGCGC ATCCACCACTCCTGATGCAGTAATCCTACGGTGCGGAATGTGGTGGCCTC GAGCAAGAGAACGGAGTGAACCCACCATCCGCGGGATTTATCCTGAATAG AGCCCAGCTTGCCAAGCTCTTCGGCGACCTGGTGGCGATAACTCAAAGAG GTGGTGTCCTCAATGGCCAGCAGTTCGGGAAACTCCTGAGCCAACTTGAC TGTTTGCATGGCGCCAGCCTTTCTGATCGCCTCGGCAGAAACGTTGGGAT TGCGGTAAAATCGGTAAGCGCCTTCCTGCATGGCTTCACTACCCTCTGAT GAGATGGTTATTGATTTACCAGAATATTTTGCCAATTGGGCGGCGACGTT AACCAAGCGGGCAGTACGGCGAGGATCACCCAGCGCCGCCGAAGAGAACA CAGATTTAGCCCAGTCGGCCGCACGATGAAGAGCAGAAGTTATCATGAAC GTTACCATGTTAGGAGGTCACATGGAAGTCAGATCCTGGAAAACGGGAAA GGTTCCGTTCAGGACGCTACTTGTGTATAAGAGTCAG



Back to Vector page


Back to Homepage