TnTIN

Reference:

Ehrmann, M., Bolek, P., Mondigler, M., Boyd, D., and R. Lange 1997. TnTIN and TnTAP: mini-transposons for site specific proteolysis in vivo. Proc. Natl. Acad. Sci. USA 94:13111-13115 entrez/medline
View PDF file

Nucleotide sequence of TnTIN

CTGACTCTTATACACAAGTttGAAAACCTGTACTTCCAGTCAgcggccgc catggtccgtcctgtagaaaccccaacccgtgaaatcaaaaaactcgacg gcctgtgggcattcagtctggatcgcgaaaactgtggaattgatcagcgt tggtgggaaagcgcgttacaagaaagccgggcaattgctgtgccaggcag ttttaacgatcagttcgccgatgcagatattcgtaattatgcgggcaacg tctggtatcagcgcgaagtctttataccgaaaggttgggcaggccagcgt atcgtgctgcgtttcgatgcggtcactcattacggcaaagtgtgggtcaa taatcaggaagtgatggagcatcagggcggctatacgccatttgaagccg atgtcacgccgtatgttattgccgggaaaagtgtacgtatcaccgtttgt gtgaacaacgaactgaactggcagactatcccgccgggaatggtgattac cgacgaaaacggcaagaaaaagcagtcttacttccatgatttctttaact atgccggaatccatcgcagcgtaatgctctacaccacgccgaacacctgg gtggacgatatcaccgtggtgacgcatgtcgcgcaagactgtaaccacgc gtctgttgactggcaggtggtggccaatggtgatgtcagcgttgaactgc gtgatgcggatcaacaggtggttgcaactggacaaggcactagcgggact ttgcaagtggtgaatccgcacctctggcaaccgggtgaaggttatctcta tgaactgtgcgtcacagccaaaagccagacagagtgtgatatctacccgc ttcgcgtcggcatccggtcagtggcagtgaagggccaacagttcctgatt aaccacaaaccgttctactttactggctttggtcgtcatgaagatgcgga cttacgtggcaaaggattcgataacgtgctgatggtgcacgaccacgcat taatggactggattggggccaactcctaccgtacctcgcattacccttac gctgaagagatgctcgactgggcagatgaacatggcatcgtggtgattga tgaaactgctgctgtcggcttttcgctctctttaggcattggtttcgaag cgggcaacaagccgaaagaactgtacagcgaagaggcagtcaacggggaa actcagcaagcgcacttacaggcgattaaagagctgatagcgcgtgacaa aaaccacccaagcgtggtgatgtggagtattgccaacgaaccggataccc gtccgcaaggtgcacgggaatatttcgcgccactggcggaagcaacgcgt aaactcgacccgacgcgtccgatcacctgcgtcaatgtaatgttctgcga cgctcacaccgataccatcagcgatctctttgatgtgctgtgcctgaacc gttattacggatggtatgtccaaagcggcgatttggaaacggcagagaag gtactggaaaaagaacttctggcctggcaggagaaactgcatcagccgat tatcatcaccgaatacggcgtggatacgttagccgggctgcactcaatgt acaccgacatgtggagtgaagagtatcagtgtgcatggctggatatgtat caccgcgtctttgatcgcgtcagcgccgtcgtcggtgaacaggtatggaa tttcgccgattttgcgacctcgcaaggcatattgcgcgttggcggtaaca agaaagggatcttcactcgcgaccgcaaaccgaagtcggcggcttttctg ctgcaaaaacgctggactggcatgaacttcggtgaaaaaccgcagcaggg aggcaaacaatgaatcaacaactctcctggcgcaccatcgtcggctacag cctcggtggggaattcGTCGACCTGCAgggggggggggGCGCTgaggtct gcctcgtgaagaaggtgttgctgactcataccaggcctgaatcgccccat catccagcccagaaagtgagggagccacggttgatgagagctttgttgta ggtggaccagttggtgattttgaacttttgctttgccacggaacggtctg cgttgtcgggaagatgcgtgatctgatccttcaactccagcaaaagttcg atttattcaacAAAGCCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCCA GTGTTACAACCAATTAACCAATTCTGATTAgaaaaactcatcgagcatca aatgaaactgcaatttattcatatcaggattatcAAtaccatatttttga aaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccatag gatggcaagatcctggtatcggtctgcgattccgactcgtccaacatcaa tacaACCtattaatttcccctcgtcaaaaataaggttatcaagtgagaaa tcaccatgagtgacgactgaatccggtgagaatggcaaaagcttatgcat ttctttccagacttgttgaacaggCCAgccattacgctcgtcatcaaaat cactcgcatcaaccaaaccgttattcattcgtgattgcgcctgagcgaga cgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatCGAAtg caaccggcgcaggaacactgccagcgcatcaacaatattttcacctgaat caggatattcttctaatacctggaatgctgttttcccggggatcgcagtg gtgagtaaccatgcATCatcaggagtacggataaaatgcttgatggtcgg aagaggcataaattccgtcagccagtttagTCtgaccatctcatctgtaa catcattggcaacgctacctttgccatgtttcagAAAcaactctggcgca tcgggcttcccatacaatcgatagattgtcgcacctgattgcccgacatt atcgcgagcccatttatAcccatataaatcagcatccatgttggaattta atcgcggcctcgagcaagacgtttcccgttgaatatgGCTCATaacaccc cttgtattactgtttatgtaagcagacagttttattgttcatgatgatat atttttatcttgtgcaatgtaacatcagagattttgagacacaacgtGGC TTTgttgaataaatcgaacttttgctggagttgaaggatcagatcacgca tcttcccgacaacgcagaccgttccgtggcaaagcaaaagttcaaaatca ccaactggtccacctacaacaaagctctcatcaaccgtggctccctcact ttctgggctggatgatggggcgattcaggcctggtatgagtcagcaacac cttcttcacgaggcagacctcAGCGCcccccccccccTGCAGGTCGACgc ggccgcaaTACTTGTGTATAAGAGTCAG



Back to Vector page


Back to Homepage