Phage fd

- References:

Beck E, Sommer R, Auerswald EA, Kurz C, Zink B, Osterburg G, Schaller H, Sugimoto K, Sugisaki H, Okamoto T and Takanami M. 1978. Nucleotide sequence of bacteriophage fd DNA. Nucleic Acids Res. 5:4495-503.

van Wezenbeek PM, Hulsebos TJ and Schoenmakers JG. 1980. Nucleotide sequence of the filamentous bacteriophage M13 DNA genome: comparison with phage fd. Gene 11:129-148.

Beck E, Zink B. 1981. Nucleotide sequence and genome organisation of filamentous bacteriophages fl and fd. Gene 16:35-58.


AACGCTACTACCATTAGTAGAATTGATGCCACCTTTTCAGCTCGCGCCCC AAATGAAAATATAGCTAAACAGGTTATTGACCATTTGCGAAATGTATCTA ATGGTCAAACTAAATCTACTCGTTCGCAGAATTGGGAATCAACTGTTACA TGGAATGAAACTTCCAGACACCGTACTTTAGTTGCATATTTAAAACATGT TGAACTACAGCACCAGATTCAGCAATTAAGCTCTAAGCCATCCGCAAAAA TGACCTCTTATCAAAAGGAGCAATTAAAGGTACTGTCTAATCCTGACCTG TTGGAATTTGCTTCCGGTCTGGTTCGCTTTGAGGCTCGAATTGAAACGCG ATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATTCGCT TTGCTTCTGACTATAATAGACAGGGTAAAGACCTGATTTTTGATTTATGG TCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGAGGGGGATTCAATGAA TATTTATGACGATTCCGCAGTATTGGACGCTATCCAGTCTAAACATTTTA CAATTACCCCCTCTGGCAAAACTTCCTTTGCAAAAGCCTCTCGCTATTTT GGTTTCTATCGTCGTCTGGTTAATGAGGGTTATGATAGTGTTGCTCTTAC CATGCCTCGTAATTCCTTTTGGCGTTATGTATCTGCATTAGTTGAGTGTG GTATTCCTAAATCTCAATTGATGAATCTTTCCACCTGTAATAATGTTGTT CCGTTAGTTCGTTTTATTAACGTAGATTTTTCCTCCCAACGTCCTGACTG GTATAATGAGCCAGTTCTTAAAATCGCATAAGGTAATTCAAAATGATTAA AGTTGAAATTAAACCGTCTCAAGCGCAATTTACTACCCGTTCTGGTGTTT CTCGTCAGGGCAAGCCTTATTCACTGAATGAGCAGCTTTGTTACGTTGAT TTGGGTAATGAATATCCGGTGCTTGTCAAGATTACTCTCGACGAAGGTCA GCCAGCGTATGCGCCTGGTCTGTACACCGTGCATCTGTCCTCGTTCAAAG TTGGTCAGTTCGGTTCTCTTATGATTGACCGTCTGCGCCTCGTTCCGGCT AAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGATGA TACAAATCTCCGTTGTACTTTGTTTCGCGCTTGGTATAATCGCTGGGGGT CAAAGATGAGTGTTTTAGTGTATTCTTTCGCCTCTTTCGTTTTAGGTTGG TGCCTTCGTAGTGGCATTACGTATTTTACCCGTTTAATGGAAACTTCCTC ATGAAAAAGTCTTTAGTCCTCAAAGCCTCCGTAGCCGTTGCTACCCTCGT TCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCCT TTGACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCG ATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAA ATTCACCTCGAAAGCAAGCTGATAAACCGATACAATTAAAGGCTCCTTTT GGAGCCTTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAA TTCCTTTAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTGAAAGT TGTTTAGCAAAACCTCATACAGAAAATTCATTTACTAACGTCTGGAAAGA CGACAAAACTTTAGATCGTTACGCTAACTATGAGGGCTGTCTGTGGAATG CTACAGGCGTTGTGGTTTGTACTGGTGACGAAACTCAGTGTTACGGTACA TGGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCTCTGA GGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTC CTGAGTACGGTGATACACCTATTCCGGGCTATACTTATATCAACCCTCTC GACGGCACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCC TTCTCTTGAGGAGTCTCAGCCTCTTAATACTTTCATGTTTCAGAATAATA GGTTCCGAAATAGGCAGGGTGCATTAACTGTTTATACGGGCACTGTTACT CAAGGCACTGACCCCGTTAAAACTTATTACCAGTACACTCCTGTATCATC AAAAGCCATGTATGACGCTTACTGGAACGGTAAATTCAGAGACTGCGCTT TCCATTCTGGCTTTAATGAGGATCCATTCGTTTGTGAATATCAAGGCCAA TCGTCTGACCTGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGG TGGTTCTGGTGGCGGCTCTGAGGGTGGCGGCTCTGAGGGTGGCGGTTCTG AGGGTGGCGGCTCTGAGGGTGGCGGTTCCGGTGGCGGCTCCGGTTCCGGT GATTTTGATTATGAAAAAATGGCAAACGCTAATAAGGGGGCTATGACCGA AAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATT CTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTT TCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAA TTCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATGAATA ATTTCCGTCAATATTTACCTTCTTTGCCTCAGTCGGTTGAATGTCGCCCT TATGTCTTTGGCGCTGGTAAACCATATGAATTTTCTATTGATTGTGACAA AATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCT TTATGTATGTATTTTCGACGTTTGCTAACATACTGCGTAATAAGGAGTCT TAATCATGCCAGTTCTTTTGGGTATTCCGTTATTATTGCGTTTCCTCGGT TTCCTTCTGGTAACTTTGTTCGGCTATCTGCTTACTTTCCTTAAAAAGGG CTTCGGTAAGATAGCTATTGCTATTTCATTGTTTCTTGCTCTTATTATTG GGCTTAACTCAATTCTTGTGGGTTATCTCTCTGATATTAGCGCACAATTA CCCTCTGATTTTGTTCAGGGCGTTCAGTTAATTCTCCCGTCTAATGCGCT TCCCTGTTTTTATGTTATTCTCTCTGTAAAGGCTGCTATTTTCATTTTTG ACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAAATATGG CTGTTTATTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGC GTTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCAAAATAGCAACTAA TCTTGATTTAAGGCTTCAAAACCTCCCGCAAGTCGGGAGGTTCGCTAAAA CGCCTCGCGTTCTTAGAATACCGGATAAGCCTTCTATTTCTGATTTGCTT GCTATTGGTCGTGGTAATGATTCCTACGACGAAAATAAAAACGGTTTGCT TGTTCTTGATGAATGCGGTACTTGGTTTAATACCCGTTCATGGAATGACA AGGAAAGACAGCCGATTATTGATTGGTTTCTTCATGCTCGTAAATTGGGA TGGGATATTATTTTTCTTGTTCAGGATTTATCTATTGTTGATAAACAGGC GCGTTCTGCATTAGCTGAACACGTTGTTTATTGTCGCCGTCTGGACAGAA TTACTTTACCCTTTGTCGGCACTTTATATTCTCTTGTTACTGGCTCAAAA ATGCCTCTGCCTAAATTACATGTTGGTGTTGTTAAATATGGTGATTCTCA ATTAAGCCCTACTGTTGAGCGTTGGCTTTATACTGGTAAGAATTTATATA ACGCATATGACACTAAACAGGCTTTTTCCAGTAATTATGATTCAGGTGTT TATTCATATTTAACCCCTTATTTATCACACGGTCGGTATTTCAAACCATT AAATTTAGGTCAGAAGATGAAATTAACTAAAATATATTTGAAAAAGTTTT CTCGCGTTCTTTGTCTTGCGATAGGATTTGCATCAGCATTTACATATAGT TATATAACCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGACCTA TGATTTTGATAAATTCACTATTGACTCTTCTCAGCGTCTTAATCTAAGCT ATCGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCGACGAT TTACAGAAGCAAGGTTATTCCATCACATATATTGATTTATGTACTGTTTC AATTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAATTTTGTT TTCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAAGTAATTGAAATGAA TAATTCGCCTCTGCGCGATTTCGTGACTTGGTATTCAAAGCAAACAGGTG AATCTGTTATTGTCTCACCTGATGTTAAAGGTACAGTGACTGTATATTCC TCTGACGTTAAGCCTGAAAATTTACGCAATTTCTTTATCTCTGTTTTACG TGCTAATAATTTTGATATGGTTGGCTCAATTCCTTCCATAATTCAGAAAT ATAACCCAAATAGTCAGGATTATATTGATGAATTGCCATCATCTGATATT CAGGAATATGATGATAATTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCA AAATGATAATGTTACTCAAACATTTAAAATTAATAACGTTCGCGCAAAGG ATTTAATAAGGGTTGTAGAATTGTTTGTTAAATCTAATACATCTAAATCC TCAAATGTATTATCTGTTGATGGTTCTAACTTATTAGTAGTTAGCGCCCC TAAAGATATTTTAGATAACCTTCCGCAATTTCTTTCTACTGTTGATTTGC CAACTGACCAGATATTGATTGAAGGATTAATTTTCGAGGTTCAGCAAGGT GATGCTTTAGATTTTTCCTTTGCTGCTGGCTCTCAGCGCGGCACTGTTGC TGGTGGTGTTAATACTGACCGTCTAACCTCTGTTTTATCTTCTGCGGGTG GTTCGTTCGGTATTTTTAACGGCGATGTTTTAGGGCTATCAGTTCGCGCA TTAAAGACTAATAGCCATTCAAAAATATTGTCTGTGCCTCGTATTCTTAC GCTTTCAGGTCAGAAGGGTTCTATTTCTGTTGGCCAGAATGTCCCTTTTA TTACTGGTCGTGTAACTGGTGAATCTGCCAATGTAAATAATCCATTTCAG ACGGTTGAGCGTCAAAATGTTGGTATTTCTATGAGTGTTTTTCCCGTTGC AATGGCTGGCGGTAATATTGTTTTAGATATAACCAGTAAGGCCGATAGTT TGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGAAGTATT GCGACAACGGTTAATTTGCGTGATGGTCAGACTCTTTTGCTCGGTGGCCT CACTGATTACAAAAACACTTCTCAAGATTCTGGTGTGCCGTTCCTGTCTA AAATCCCTTTAATCGGCCTCCTGTTTAGCTCCCGTTCTGATTCTAACGAG GAAAGCACGTTGTACGTGCTCGTCAAAGCAACCATAGTACGCGCCCTGTA GCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCT ACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTT TCTCGCCACGTTCTCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGATCC CTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCTCCAAAAACTT GATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTT TCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCC AAACTGGAACAACACTCACAACTAACTCGGCCTATTCTTTTGATTTATAA GGATTTTTGTCATTTTCTGCTTACTGGTTAAAAAATAAGCTGATTTAACA AATATTTAACGCGAAATTTAACAAAACATTAACGTTTACAATTTAAATAT TTGCTTATACAATCATCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGG GTACATATGATTGACATGCTAGTTTTACGATTACCGTTCATCGATTCTCT TGTTTGCTCCAGACTTTCAGGTAATGACCTGATAGCCTTTGTAGACCTCT CAAAAATAGCTACCCTCTCCGGCATGAATTTATCAGCTAGAACGGTTGAA TATCATATTGACGGTGATTTGACTGTCTCCGGCCTTTCTCACCCGTTTGA ATCTTTGCCTACTCATTACTCCGGCATTGCATTTAAAATATATGAGGGTT CTAAAAATTTTTATCCCTGCGTTGAAATTAAGGCTTCACCAGCAAAAGTA TTACAGGGTCATAATGTTTTTGGTACAACCGATTTAGCTTTATGCTCTGA GGCTTTATTGCTTAATTTTGCTAACTCTCTGCCTTGCTTGTACGATTTAT TGGATGTT



Back to DNA page
Back to Homepage