Phage T7 complete genome

- Reference:

Dunn,J.J. and Studier,F.W. 1983. Complete nucleotide sequence of bacteriophage T7 DNA and the locations of T7 genetic elements. J. Mol. Biol. 166: 477-535.



tctcacagtgtacggacctaaagttcccccatagggggtacctaaagccc agccaatcacctaaagtcaaccttcggttgaccttgagggttccctaagg gttggggatgacccttgggtttgtctttgggtgttaccttgagtgtctct ctgtgtccctatctgttacagtctcctaaagtatcctcctaaagtcacct cctaacgtccatcctaaagccaacacctaaagcctacacctaaagaccca tcaagtcaacgcctatcttaaagtttaaacataaagaccagacctaaaga ccagacctaaagacactacataaagaccagacctaaagacgccttgttgt tagccataaagtgataacctttaatcattgtctttattaatacaactcac tataaggagagacaacttaaagagacttaaaagattaatttaaaatttat caaaaagagtattgacttaaagtctaacctataggatacttacagccatc gagagggacacggcgaatagccatcccaatcgacaccggggtcaaccgga taagtagacagcctgataagtcgcacgaaaaacaggtattgacaacatga agtaacatgcagtaagatacaaatcgctaggtaacactagcagcgtcaac cgggcgcacagtgccttctaggtgacttaagcgcaccacggcacataagg tgaaacaaaacggttgacaacatgaagtaaacacggtacgatgtaccaca tgaaacgacagtgagtcaccacactgaaaggtgatgcggtctaacgaaac ctgacctaagacgctctttaacaatctggtaaatagctcttgagtgcatg actagcggataactcaagggtatcgcaaggtgccctttatgatattcact aataactgcacgaggtaacacaagatggctatgtctaacatgacttacaa caacgttttcgaccacgcttacgaaatgctgaaagaaaacatccgttatg atgacatccgtgacactgatgacctgcacgatgctattcacatggctgcc gataatgcagttccgcactactacgctgacatctttagcgtaatggcaag tgagggcattgaccttgagttcgaagactctggtctgatgcctgacacca aggacgtaatccgcatcctgcaagcgcgtatctatgagcaattaacgatt gacctctgggaagacgcagaagacttgctcaatgaatacttggaggaagt cgaggagtacgaggaggatgaagagtaatgtctactaccaacgtgcaata cggtctgaccgctcaaactgtacttttctatagcgacatggtgcgctgtg gctttaactggtcactcgcaatggcacagctcaaagaactgtacgaaaac aacaaggcaatagctttagaatctgctgagtgatagactcaaggtcgctc ctagcgagtggcctttatgattatcactttacttatgagggagtaatgta tatgcttactatcggtctactcaccgctctaggtctagctgtaggtgcat cctttgggaaggctttaggtgtagctgtaggttcctactttaccgcttgc atcatcataggaatcatcaaaggggcactacgcaaatgatgaagcactac gttatgccaatccacacgtccaacggggcaaccgtatgtacacctgatgg gttcgcaatgaaacaacgaatcgaacgccttaagcgtgaactccgcatta accgcaagattaacaagataggttccggctatgacagaacgcactgatgg cttaaagaaaggttatatgcccaatggcacactatacgctgcaaatcggc gaatagtgagaacttggcgagagaacaacctcgaacgccgcaaggacaag agagggcggcgtggcatagacgaaaggaaaaggttaaagccaagaaactc gccgcacttgaacaggcactagccaacacactgaacgctatctcataacg aacataaaggacacaatgcaatgaacattaccgacatcatgaacgctatc gacgcaatcaaagcactgccaatctgtgaacttgacaagcgtcaaggtat gcttatcgacttactggtcgagatggtcaacagcgagacgtgtgatggcg agctaaccgaactaaatcaggcacttgagcatcaagattggtggactacc ttgaagtgtctcacggctgacgcagggttcaagatgctcggtaatggtca cttctcggctgcttatagtcacccgctgctacctaacagagtgattaagg tgggctttaagaaagaggattcaggcgcagcctataccgcattctgccgc atgtatcagggtcgtcctggtatccctaacgtctacgatgtacagcgcca cgctggatgctatacggtggtacttgacgcacttaaggattgcgagcgtt tcaacaatgatgcccattataaatacgctgagattgcaagcgacatcatt gattgcaattcggatgagcatgatgagttaactggatgggatggtgagtt tgttgaaacttgtaaactaatccgcaagttctttgagggcatcgcctcat tcgacatgcatagcgggaacatcatgttctcaaatggagacgtaccatac atcaccgacccggtatcattctcgcagaagaaagacggtggcgcattcag catcgaccctgaggaactcatcaaggaagtcgaggaagtcgcacgacaga aagaaattgaccgcgctaaggcccgtaaagaacgtcacgaggggcgctta gaggcacgcagattcaaacgtcgcaaccgcaaggcacgtaaagcacacaa agctaagcgcgaaagaatgcttgctgcgtggcgatgggctgaacgtcaag aacggcgtaaccatgaggtagctgtagatgtactaggaagaaccaataac gctatgctctgggtcaacatgttctctggggactttaaggcgcttgagga acgaatcgcgctgcactggcgtaatgctgaccggatggctatcgctaatg gtcttacgctcaacattgataagcaacttgacgcaatgttaatgggctga tagtcttatcttacaggtcatctgcgggtggcctgaataggtacgattta ctaactggaagaggcactaaatgaacacgattaacatcgctaagaacgac ttctctgacatcgaactggctgctatcccgttcaacactctggctgacca ttacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtctt acgagatgggtgaagcacgcttccgcaagatgtttgagcgtcaacttaaa gctggtgaggttgcggataacgctgccgccaagcctctcatcactaccct actccctaagatgattgcacgcatcaacgactggtttgaggaagtgaaag ctaagcgcggcaagcgcccgacagccttccagttcctgcaagaaatcaag ccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaac cagtgctgacaatacaaccgttcaggctgtagcaagcgcaatcggtcggg ccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaag cacttcaagaaaaacgttgaggaacaactcaacaagcgcgtagggcacgt ctacaagaaagcatttatgcaagttgtcgaggctgacatgctctctaagg gtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctatt catgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggt tagcttacaccgccaaaatgctggcgtagtaggtcaagactctgagacta tcgaactcgcacctgaatacgctgaggctatcgcaacccgtgcaggtgcg ctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagcc gtggactggcattactggtggtggctattgggctaacggtcgtcgtcctc tggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagac gtttacatgcctgaggtgtacaaagcgattaacattgcgcaaaacaccgc atggaaaatcaacaagaaagtcctagcggtcgccaacgtaatcaccaagt ggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactc ccgatgaaaccggaagacatcgacatgaatcctgaggctctcaccgcgtg gaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctc gccgtatcagccttgagttcatgcttgagcaagccaataagtttgctaac cataaggccatctggttcccttacaacatggactggcgcggtcgtgttta cgctgtgtcaatgttcaacccgcaaggtaacgatatgaccaaaggactgc ttacgctggcgaaaggtaaaccaatcggtaaggaaggttactactggctg aaaatccacggtgcaaactgtgcgggtgtcgataaggttccgttccctga gcgcatcaagttcattgaggaaaaccacgagaacatcatggcttgcgcta agtctccactggagaacacttggtgggctgagcaagattctccgttctgc ttccttgcgttctgctttgagtacgctggggtacagcaccacggcctgag ctataactgctcccttccgctggcgtttgacgggtcttgctctggcatcc agcacttctccgcgatgctccgagatgaggtaggtggtcgcgcggttaac ttgcttcctagtgaaaccgttcaggacatctacgggattgttgctaagaa agtcaacgagattctacaagcagacgcaatcaatgggaccgataacgaag tagttaccgtgaccgatgagaacactggtgaaatctctgagaaagtcaag ctgggcactaaggcactggctggtcaatggctggcttacggtgttactcg cagtgtgactaagcgttcagtcatgacgctggcttacgggtccaaagagt tcggcttccgtcaacaagtgctggaagataccattcagccagctattgat tccggcaagggtctgatgttcactcagccgaatcaggctgctggatacat ggctaagctgatttgggaatctgtgagcgtgacggtggtagctgcggttg aagcaatgaactggcttaagtctgctgctaagctgctggctgctgaggtc aaagataagaagactggagagattcttcgcaagcgttgcgctgtgcattg ggtaactcctgatggtttccctgtgtggcaggaatacaagaagcctattc agacgcgcttgaacctgatgttcctcggtcagttccgcttacagcctacc attaacaccaacaaagatagcgagattgatgcacacaaacaggagtctgg tatcgctcctaactttgtacacagccaagacggtagccaccttcgtaaga ctgtagtgtgggcacacgagaagtacggaatcgaatcttttgcactgatt cacgactccttcggtaccattccggctgacgctgcgaacctgttcaaagc agtgcgcgaaactatggttgacacatatgagtcttgtgatgtactggctg atttctacgaccagttcgctgaccagttgcacgagtctcaattggacaaa atgccagcacttccggctaaaggtaacttgaacctccgtgacatcttaga gtcggacttcgcgttcgcgtaacgccaaatcaatacgactcactatagag ggacaaactcaaggtcattcgcaagagtggcctttatgattgaccttctt ccggttaatacgactcactataggagaaccttaaggtttaactttaagac ccttaagtgttaattagagatttaaattaaagaattactaagagaggact ttaagtatgcgtaacttcgaaaagatgaccaaacgttctaaccgtaatgc tcgtgacttcgaggcaaccaaaggtcgcaagttgaataagactaagcgtg accgctctcacaagcgtagctgggagggtcagtaagatgggacgtttata tagtggtaatctggcagcattcaaggcagcaacaaacaagctgttccagt tagacttagcggtcatttatgatgactggtatgatgcctatacaagaaaa gattgcatacggttacgtattgaggacaggagtggaaacctgattgatac tagcaccttctaccaccacgacgaggacgttctgttcaatatgtgtactg attggttgaaccatatgtatgaccagttgaaggactggaagtaatacgac tcagtatagggacaatgcttaaggtcgctctctaggagtggccttagtca tttaaccaataggagataaacattatgatgaacattaagactaacccgtt taaagccgtgtctttcgtagagtctgccattaagaaggctctggataacg ctgggtatcttatcgctgaaatcaagtacgatggtgtacgcgggaacatc tgcgtagacaatactgctaacagttactggctctctcgtgtatctaaaac gattccggcactggagcacttaaacgggtttgatgttcgctggaagcgtc tactgaacgatgaccgttgcttctacaaagatggctttatgcttgatggg gaactcatggtcaagggcgtagactttaacacagggtccggcctactgcg taccaaatggactgacacgaagaaccaagagttccatgaagagttattcg ttgaaccaatccgtaagaaagataaagttccctttaagctgcacactgga caccttcacataaaactgtacgctatcctcccgctgcacatcgtggagtc tggagaagactgtgatgtcatgacgttgctcatgcaggaacacgttaaga acatgctgcctctgctacaggaatacttccctgaaatcgaatggcaagcg gctgaatcttacgaggtctacgatatggtagaactacagcaactgtacga gcagaagcgagcagaaggccatgagggtctcattgtgaaagacccgatgt gtatctataagcgcggtaagaaatctggctggtggaaaatgaaacctgag aacgaagctgacggtatcattcagggtctggtatggggtacaaaaggtct ggctaatgaaggtaaagtgattggttttgaggtgcttcttgagagtggtc gtttagttaacgccacgaatatctctcgcgccttaatggatgagttcact gagacagtaaaagaggccaccctaagtcaatggggattctttagcccata cggtattggcgacaacgatgcttgtactattaacccttacgatggctggg cgtgtcaaattagctacatggaggaaacacctgatggctctttgcggcac ccatcgttcgtaatgttccgtggcaccgaggacaaccctcaagagaaaat gtaatcacactggctcaccttcgggtgggcctttctgcgtttataaggag acactttatgtttaagaaggttggtaaattccttgcggctttggcagcta tcctgacgcttgcgtatattcttgcggtataccctcaagtagcactagta gtagttggcgcttgttacttagcggcagtgtgtgcttgcgtgtggagtat agttaactggtaatacgactcactaaaggaggtacacaccatgatgtact taatgccattactcatcgtcattgtaggatgccttgcgctccactgtagc gatgatgatatgccagatggtcacgcttaatacgactcactaaaggagac actatatgtttcgacttcattacaacaaaagcgttaagaatttcacggtt cgccgtgctgaccgttcaatcgtatgtgcgagcgagcgccgagctaagat acctcttattggtaacacagttcctttggcaccgagcgtccacatcatta tcacccgtggtgactttgagaaagcaatagacaagaaacgtccggttctt agtgtggcagtgacccgcttcccgttcgtccgtctgttactcaaacgaat caaggaggtgttctgatgggactgttagatggtgaagcctgggaaaaaga aaacccgccagtacaagcaactgggtgtatagcttgcttagagaaagatg accgttatccacacacctgtaacaaaggagctaacgatatgaccgaacgt gaacaagagatgatcattaagttgatagacaataatgaaggtcgcccaga tgatttgaatggctgcggtattctctgctccaatgtcccttgccacctct gccccgcaaataacgatcaaaagataaccttaggtgaaatccgagcgatg gacccacgtaaaccacatctgaataaacctgaggtaactcctacagatga ccagccttccgctgagacaatcgaaggtgtcactaagccttcccactaca tgctgtttgacgacattgaggctatcgaagtgattgctcgttcaatgacc gttgagcagttcaagggatactgcttcggtaacatcttaaagtacagact acgtgctggtaagaagtcagagttagcgtacttagagaaagacctagcga aagcagacttctataaagaactctttgagaaacataaggataaatgttat gcataacttcaagtcaaccccacctgccgacagcctatctgatgacttca catcttgctcagagtggtgccgaaagatgtgggaagagacattcgacgat gcgtacatcaagctgtatgaactttggaaatcgagaggtcaatgactatg tcaaacgtaaatacaggttcacttagtgtggacaataagaagttttgggc taccgtagagtcctcggagcattccttcgaggttccaatctacgctgaga ccctagacgaagctctggagttagccgaatggcaatacgttccggctggc tttgaggttactcgtgtgcgtccttgtgtagcaccgaagtaatacgactc actattagggaagactccctctgagaaaccaaacgaaacctaaaggagat taacattatggctaagaagattttcacctctgcgctgggtaccgctgaac cttacgcttacatcgccaagccggactacggcaacgaagagcgtggcttt gggaaccctcgtggtgtctataaagttgacctgactattcccaacaaaga cccgcgctgccagcgtatggtcgatgaaatcgtgaagtgtcacgaagagg cttatgctgctgccgttgaggaatacgaagctaatccacctgctgtagct cgtggtaagaaaccgctgaaaccgtatgagggtgacatgccgttcttcga taacggtgacggtacgactacctttaagttcaaatgctacgcgtctttcc aagacaagaagaccaaagagaccaagcacatcaatctggttgtggttgac tcaaaaggtaagaagatggaagacgttccgattatcggtggtggctctaa gctgaaagttaaatattctctggttccatacaagtggaacactgctgtag gtgcgagcgttaagctgcaactggaatccgtgatgctggtcgaactggct acctttggtggcggtgaagacgattgggctgacgaagttgaagagaacgg ctatgttgcctctggttctgccaaagcgagcaaaccacgcgacgaagaaa gctgggacgaagacgacgaagagtccgaggaagcagacgaagacggagac ttctaagtggaactgcgggagaaaatccttgagcgaatcaaggtgacttc ctctgggtgttgggagtggcagggcgctacgaacaataaagggtacgggc aggtgtggtgcagcaataccggaaaggttgtctactgtcatcgcgtaatg tctaatgctccgaaaggttctaccgtcctgcactcctgtgataatccatt atgttgtaaccctgaacacctatccataggaactccaaaagagaactcca ctgacatggtaaataagggtcgctcacacaaggggtataaactttcagac gaagacgtaatggcaatcatggagtccagcgagtccaatgtatccttagc tcgcacctatggtgtctcccaacagactatttgtgatatacgcaaaggga ggcgacatggcaggttacggcgctaaaggaatccgaaaggttggagcgtt tcgctctggcctagaggacaaggtttcaaagcagttggaatcaaaaggta ttaaattcgagtatgaagagtggaaagtgccttatgtaattccggcgagc aatcacacttacactccagacttcttacttccaaacggtatattcgttga gacaaagggtctgtgggaaagcgatgatagaaagaagcacttattaatta gggagcagcaccccgagctagacatccgtattgtcttctcaagctcacgt actaagttatacaaaggttctccaacgtcttatggagagttctgcgaaaa gcatggtattaagttcgctgataaactgatacctgctgagtggataaagg aacccaagaaggaggtcccctttgatagattaaaaaggaaaggaggaaag aaataatggctcgtgtacagtttaaacaacgtgaatctactgacgcaatc tttgttcactgctcggctaccaagccaagtcagaatgttggtgtccgtga gattcgccagtggcacaaagagcagggttggctcgatgtgggataccact ttatcatcaagcgagacggtactgtggaggcaggacgagatgagatggct gtaggctctcacgctaagggttacaaccacaactctatcggcgtctgcct tgttggtggtatcgacgataaaggtaagttcgacgctaactttacgccag cccaaatgcaatcccttcgctcactgcttgtcacactgctggctaagtac gaaggcgctgtgcttcgcgcccatcatgaggtggcgccgaaggcttgccc ttcgttcgaccttaagcgttggtgggagaagaacgaactggtcacttctg accgtggataattaattgaactcactaaagggagaccacagcggtttccc tttgttcgcattggaggtcaaataatgcgcaagtcttataaacaattcta taaggctccgaggaggcatatccaagtgtgggaggcagccaatgggccta taccaaaaggttattatatagaccacattgacggcaatccactcaacgac gccttagacaatctccgtctggctctcccaaaagaaaactcatggaacat gaagactccaaagagcaatacctcaggactaaagggactgagttggagca aggaaagggagatgtggagaggcactgtaacagctgagggtaaacagcat aactttcgtagtagagatctattggaagtcgttgcgtggatttatagaac taggagggaattgcatggacaattcgcacgattccgatagtgtatttctt taccacattccttgtgacaactgtgggagtagtgatgggaactcgctgtt ctctgacggacacacgttctgctacgtatgcgagaagtggactgctggta atgaagacactaaagagagggcttcaaaacggaaaccctcaggaggtaaa ccaatgacttacaacgtgtggaacttcggggaatccaatggacgctactc cgcgttaactgcgagaggaatctccaaggaaacctgtcagaaggctggct actggattgccaaagtagacggtgtgatgtaccaagtggctgactatcgg gaccagaacggcaacattgtgagtcagaaggttcgagataaagataagaa ctttaagaccactggtagtcacaagagtgacgctctgttcgggaagcact tgtggaatggtggtaagaagattgtcgttacagaaggtgaaatcgacatg cttaccgtgatggaacttcaagactgtaagtatcctgtagtgtcgttggg tcacggtgcctctgccgctaagaagacatgcgctgccaactacgaatact ttgaccagttcgaacagattatcttaatgttcgatatggacgaagcaggg cgcaaagcagtcgaagaggctgcacaggttctacctgctggtaaggtacg agtggcagttcttccgtgtaaggatgcaaacgagtgtcacctaaatggtc acgaccgtgaaatcatggagcaagtgtggaatgctggtccttggattcct gatggtgtggtatcggctctttcgttacgtgaacgaatccgtgagcacct atcgtccgaggaatcagtaggtttacttttcagtggctgcactggtatca acgataagaccttaggtgcccgtggtggtgaagtcattatggtcacttcc ggttccggtatgggtaagtcaacgttcgtccgtcaacaagctctacaatg gggcacagcgatgggcaagaaggtaggcttagcgatgcttgaggagtccg ttgaggagaccgctgaggaccttataggtctacacaaccgtgtccgactg agacaatccgactcactaaagagagagattattgagaacggtaagttcga ccaatggttcgatgaactgttcggcaacgatacgttccatctatatgact cattcgccgaggctgagacggatagactgctcgctaagctggcctacatg cgctcaggcttgggctgtgacgtaatcattctagaccacatctcaatcgt cgtatccgcttctggtgaatccgatgagcgtaagatgattgacaacctga tgaccaagctcaaagggttcgctaagtcaactggggtggtgctggtcgta atttgtcaccttaagaacccagacaaaggtaaagcacatgaggaaggtcg ccccgtttctattactgacctacgtggttctggcgcactacgccaactat ctgatactattattgcccttgagcgtaatcagcaaggcgatatgcctaac cttgtcctcgttcgtattctcaagtgccgctttactggtgatactggtat cgctggctacatggaatacaacaaggaaaccggatggcttgaaccatcaa gttactcaggggaagaagagtcacactcagagtcaacagactggtccaac gacactgacttctgacaggattcttgatgactttccagacgactacgaga agtttcgctggagagtcccattctaatacgactcactaaaggagacacac catgttcaaactgattaagaagttaggccaactgctggttcgtatgtaca acgtggaagccaagcgactgaacgatgaggctcgtaaagaggccacacag tcacgcgctctggcgattcgctccaacgaactggctgacagtgcatccac taaagttaccgaggctgcccgtgtggcaaaccaagctcaacagctttcca aattctttgagtaatcaaacaggagaaaccattatgtctaacgtagctga aactatccgtctatccgatacagctgaccagtggaaccgtcgagtccaca tcaacgttcgcaacggtaaggcgactatggtttaccgctggaaggactct aagtcctctaagaatcacactcagcgtatgacgttgacagatgagcaagc actgcgtctggtcaatgcgcttaccaaagctgccgtgacagcaattcatg aagctggtcgcgtcaatgaagctatggctatcctcgacaagattgataac taagagtggtatcctcaaggtcgccaaagtggtggccttcatgaatacta ttcgactcactataggagatattaccatgcgtgaccctaaagttatccaa gcagaaatcgctaaactggaagctgaactggaggacgttaagtaccatga agctaagactcgctccgctgttcacatcttgaagaacttaggctggactt ggacaagacagactggctggaagaaaccagaagttaccaagctgagtcat aaggtgttcgataaggacactatgacccacatcaaggctggtgattgggt taaggttgacatgggagttgttggtggatacggctacgtccgctcagtta gtggcaaatatgcacaagtgtcatacatcacaggtgttactccacgcggt gcaatcgttgccgataagaccaacatgattcacacaggtttcttgacagt tgtttcatatgaagagattgttaagtcacgataatcaataggagaaatca atatgatcgtttctgacatcgaagctaacgccctcttagagagcgtcact aagttccactgcggggttatctacgactactccaccgctgagtacgtaag ctaccgtccgagtgacttcggtgcgtatctggatgcgctggaagccgagg ttgcacgaggcggtcttattgtgttccacaacggtcacaagtatgacgtt cctgcattgaccaaactggcaaagttgcaattgaaccgagagttccacct tcctcgtgagaactgtattgacacccttgtgttgtcacgtttgattcatt ccaacctcaaggacaccgatatgggtcttctgcgttccggcaagttgccc ggaaaacgctttgggtctcacgctttggaggcgtggggttatcgcttagg cgagatgaagggtgaatacaaagacgactttaagcgtatgcttgaagagc agggtgaagaatacgttgacggaatggagtggtggaacttcaacgaagag atgatggactataacgttcaggacgttgtggtaactaaagctctccttga gaagctactctctgacaaacattacttccctcctgagattgactttacgg acgtaggatacactacgttctggtcagaatcccttgaggccgttgacatt gaacatcgtgctgcatggctgctcgctaaacaagagcgcaacgggttccc gtttgacacaaaagcaatcgaagagttgtacgtagagttagctgctcgcc gctctgagttgctccgtaaattgaccgaaacgttcggctcgtggtatcag cctaaaggtggcactgagatgttctgccatccgcgaacaggtaagccact acctaaataccctcgcattaagacacctaaagttggtggtatctttaaga agcctaagaacaaggcacagcgagaaggccgtgagccttgcgaacttgat acccgcgagtacgttgctggtgctccttacaccccagttgaacatgttgt gtttaacccttcgtctcgtgaccacattcagaagaaactccaagaggctg ggtgggtcccgaccaagtacaccgataagggtgctcctgtggtggacgat gaggtactcgaaggagtacgtgtagatgaccctgagaagcaagccgctat cgacctcattaaagagtacttgatgattcagaagcgaatcggacagtctg ctgagggagacaaagcatggcttcgttatgttgctgaggatggtaagatt catggttctgttaaccctaatggagcagttacgggtcgtgcgacccatgc gttcccaaaccttgcgcaaattccgggtgtacgttctccttatggagagc agtgtcgcgctgcttttggcgctgagcaccatttggatgggataactggt aagccttgggttcaggctggcatcgacgcatccggtcttgagctacgctg cttggctcacttcatggctcgctttgataacggcgagtacgctcacgaga ttcttaacggcgacatccacactaagaaccagatagctgctgaactacct acccgagataacgctaagacgttcatctatgggttcctctatggtgctgg tgatgagaagattggacagattgttggtgctggtaaagagcgcggtaagg aactcaagaagaaattccttgagaacacccccgcgattgcagcactccgc gagtctatccaacagacacttgtcgagtcctctcaatgggtagctggtga gcaacaagtcaagtggaaacgccgctggattaaaggtctggatggtcgta aggtacacgttcgtagtcctcacgctgccttgaataccctactgcaatct gctggtgctctcatctgcaaactgtggattatcaagaccgaagagatgct cgtagagaaaggcttgaagcatggctgggatggggactttgcgtacatgg catgggtacatgatgaaatccaagtaggctgccgtaccgaagagattgct caggtggtcattgagaccgcacaagaagcgatgcgctgggttggagacca ctggaacttccggtgtcttctggataccgaaggtaagatgggtcctaatt gggcgatttgccactgatacaggaggctactcatgaacgaaagacactta acaggtgctgcttctgaaatgctagtagcctacaaatttaccaaagctgg gtacactgtctattaccctatgctgactcagagtaaagaggacttggttg tatgtaaggatggtaaatttagtaaggttcaggttaaaacagccacaacg gttcaaaccaacacaggagatgccaagcaggttaggctaggtggatgcgg taggtccgaatataaggatggagactttgacattcttgcggttgtggttg acgaagatgtgcttattttcacatgggacgaagtaaaaggtaagacatcc atgtgtgtcggcaagagaaacaaaggcataaaactataggagaaattatt atggctatgacaaagaaatttaaagtgtccttcgacgttaccgcaaagat gtcgtctgacgttcaggcaatcttagagaaagatatgctgcatctatgta agcaggtcggctcaggtgcgattgtccccaatggtaaacagaaggaaatg attgtccagttcctgacacacggtatggaaggattgatgacattcgtagt acgtacatcatttcgtgaggccattaaggacatgcacgaagagtatgcag ataaggactctttcaaacaatctcctgcaacagtacgggaggtgttctga tgtctgactacctgaaagtgctgcaagcaatcaaaagttgccctaagact ttccagtccaactatgtacggaacaatgcgagcctcgtagcggaggccgc ttcccgtggtcacatctcgtgcctgactactagtggacgtaacggtggcg cttgggaaatcactgcttccggtactcgctttctgaaacgaatgggagga tgtgtctaatgtctcgtgaccttgtgactattccacgcgatgtgtggaac gatatacagggctacatcgactctctggaacgtgagaacgatagccttaa gaatcaactaatggaagctgacgaatacgtagcggaactagaggagaaac ttaatggcacttcttgaccttaaacaattctatgagttacgtgaaggctg cgacgacaagggtatccttgtgatggacggcgactggctggtcttccaag ctatgagtgctgctgagtttgatgcctcttgggaggaagagatttggcac cgatgctgtgaccacgctaaggcccgtcagattcttgaggattccattaa gtcctacgagacccgtaagaaggcttgggcaggtgctccaattgtccttg cgttcaccgatagtgttaactggcgtaaagaactggttgacccgaactat aaggctaaccgtaaggccgtgaagaaacctgtagggtactttgagttcct tgatgctctctttgagcgcgaagagttctattgcatccgtgagcctatgc ttgagggtgatgacgttatgggagttattgcttccaatccgtctgccttc ggtgctcgtaaggctgtaatcatctcttgcgataaggactttaagaccat ccctaactgtgacttcctgtggtgtaccactggtaacatcctgactcaga ccgaagagtccgctgactggtggcacctcttccagaccatcaagggtgac atcactgatggttactcagggattgctggatggggtgataccgccgagga cttcttgaataacccgttcataaccgagcctaaaacgtctgtgcttaagt ccggtaagaacaaaggccaagaggttactaaatgggttaaacgcgaccct gagcctcatgagacgctttgggactgcattaagtccattggcgcgaaggc tggtatgaccgaagaggatattatcaagcagggccaaatggctcgaatcc tacggttcaacgagtacaactttattgacaaggagatttacctgtggaga ccgtagcgtatattggtctgggtctttgtgttctcggagtgtgcctcatt tcgtggggcctttgggacttagccagaataatcaagtcgttacacgacac taagtgataaactcaaggtccctaaattaatacgactcactatagggaga taggggcctttacgattattactttaagatttaactctaagaggaatctt tattatgttaacacctattaaccaattacttaagaaccctaacgatattc cagatgtacctcgtgcaaccgctgagtatctacaggttcgattcaactat gcgtacctcgaagcgtctggtcatataggacttatgcgtgctaatggttg tagtgaggcccacatcttgggtttcattcagggcctacagtatgcctcta acgtcattgacgagattgagttacgcaaggaacaactaagagatgatggg gaggattgacactatgtgtttctcaccgaaaattaaaactccgaagatgg ataccaatcagattcgagccgttgagccagcgcctctgacccaagaagtg tcaagcgtggagttcggtgggtcttctgatgagacggataccgagggcac cgaagtgtctggacgcaaaggcctcaaggtcgaacgtgatgattccgtag cgaagtctaaagccagcggcaatggctccgctcgtatgaaatcttccatc cgtaagtccgcatttggaggtaagaagtgatgtctgagttcacatgtgtg gaggctaagagtcgcttccgtgcaatccggtggactgtggaacaccttgg gttgcctaaaggattcgaaggacactttgtgggctacagcctctacgtag acgaagtgatggacatgtctggttgccgtgaagagtacattctggactct accggaaaacatgtagcgtacttcgcgtggtgcgtaagctgtgacattca ccacaaaggagacattctggatgtaacgtccgttgtcattaatcctgagg cagactctaagggcttacagcgattcctagcgaaacgctttaagtacctt gcggaactccacgattgcgattgggtgtctcgttgtaagcatgaaggcga gacaatgcgtgtatactttaaggaggtataagttatgggtaagaaagtta agaaggccgtgaagaaagtcaccaagtccgttaagaaagtcgttaaggaa ggggctcgtccggttaaacaggttgctggcggtctagctggtctggctgg tggtactggtgaagcacagatggtggaagtaccacaagctgccgcacaga ttgttgacgtacctgagaaagaggtttccactgaggacgaagcacagaca gaaagcggacgcaagaaagctcgtgctggcggtaagaaatccttgagtgt agcccgtagctccggtggcggtatcaacatttaatcaggaggttatcgtg gaagactgcattgaatggaccggaggtgtcaactctaagggttatggtcg taagtgggttaatggtaaacttgtgactccacataggcacatctatgagg agacatatggtccagttccaacaggaattgtggtgatgcatatctgcgat aaccctaggtgctataacataaagcaccttacgcttggaactccaaaggataattccgaggacatggttaccaaaggtagacaggctaaa ggagaggaactaagcaagaaacttacagagtcagacgttctcgctatacg ctcttcaaccttaagccaccgctccttaggagaactgtatggagtcagtc aatcaaccataacgcgaatactacagcgtaagacatggagacacatttaa tggctgagaaacgaacaggacttgcggaggatggcgcaaagtctgtctat gagcgtttaaagaacgaccgtgctccctatgagacacgcgctcagaattg cgctcaatataccatcccatcattgttccctaaggactccgataacgcct ctacagattatcaaactccgtggcaagccgtgggcgctcgtggtctgaac aatctagcctctaagctcatgctggctctattccctatgcagacttggat gcgacttactatatctgaatatgaagcaaagcagttactgagcgaccccg atggactcgctaaggtcgatgagggcctctcgatggtagagcgtatcatc atgaactacattgagtctaacagttaccgcgtgactctctttgaggctct caaacagttagtcgtagctggtaacgtcctgctgtacctaccggaaccgg aagggtcaaactataatcccatgaagctgtaccgattgtcttcttatgtg gtccaacgagacgcattcggcaacgttctgcaaatggtgactcgtgacca gatagcttttggtgctctccctgaggacatccgtaaggctgtagaaggtc aaggtggtgagaagaaagctgatgagacaatcgacgtgtacactcacatc tatctggatgaggactcaggtgaatacctccgatacgaagaggtcgaggg tatggaagtccaaggctccgatgggacttatcctaaagaggcttgcccat acatcccgattcggatggtcagactagatggtgaatcctacggtcgttcg tacattgaggaatacttaggtgacttacggtcccttgaaaatctccaaga ggctatcgtcaagatgtccatgattagctctaaggttatcggcttagtga atcctgctggtatcacccagccacgccgactgaccaaagctcagactggt gacttcgttactggtcgtccagaagacatctcgttcctccaactggagaa gcaagcagactttactgtagctaaagccgtaagtgacgctatcgaggctc gcctttcgtttgcctttatgttgaactctgcggttcagcgtacaggtgaa cgtgtgaccgccgaagagattcggtatgtagcttctgaacttgaagatac tttaggtggtgtctactctatcctttctcaagaattacaattgcctctgg tacgagtgctcttgaagcaactacaagccacgcaacagattcctgagtta cctaaggaagccgtagagccaaccattagtacaggtctggaagcaattgg tcgaggacaagaccttgataagctggagcggtgtgtcactgcgtgggctg cactggcacctatgcgggacgaccctgatattaaccttgcgatgattaag ttacgtattgccaacgctatcggtattgacacttctggtattctactcac cgaagaacagaagcaacagaagatggcccaacagtctatgcaaatgggta tggataatggtgctgctgcgctggctcaaggtatggctgcacaagctaca gcttcacctgaggctatggctgctgccgctgattccgtaggtttacagcc gggaatttaatacgactcactatagggagacctcatctttgaaatgagcg atgacaagaggttggagtcctcggtcttcctgtagttcaactttaaggag acaataataatggctgaatctaatgcagacgtatatgcatcttttggcgt gaactccgctgtgatgtctggtggttccgttgaggaacatgagcagaaca tgctggctcttgatgttgctgcccgtgatggcgatgatgcaatcgagtta gcgtcagacgaagtggaaacagaacgtgacctgtatgacaactctgaccc gttcggtcaagaggatgacgaaggccgcattcaggttcgtatcggtgatg gctctgagccgaccgatgtggacactggagaagaaggcgttgagggcacc gaaggttccgaagagtttaccccactgggcgagactccagaagaactggt agctgcctctgagcaacttggtgagcacgaagagggcttccaagagatga ttaacattgctgctgagcgtggcatgagtgtcgagaccattgaggctatc cagcgtgagtacgaggagaacgaagagttgtccgccgagtcctacgctaa gctggctgaaattggctacacgaaggctttcattgactcgtatatccgtg gtcaagaagctctggtggagcagtacgtaaacagtgtcattgagtacgct ggtggtcgtgaacgttttgatgcactgtataaccaccttgagacgcacaa ccctgaggctgcacagtcgctggataatgcgttgaccaatcgtgacttag cgaccgttaaggctatcatcaacttggctggtgagtctcgcgctaaggcg ttcggtcgtaagccaactcgtagtgtgactaatcgtgctattccggctaa acctcaggctaccaagcgtgaaggctttgcggaccgtagcgagatgatta aagctatgagtgaccctcggtatcgcacagatgccaactatcgtcgtcaa gtcgaacagaaagtaatcgattcgaacttctgatagacttcgaaattaat acgactcactatagggagaccacaacggtttccctctagaaataattttg tttaactttaagaaggagatatacatatggctagcatgactggtggacag caaatgggtactaaccaaggtaaaggtgtagttgctgctggagataaact ggcgttgttcttgaaggtatttggcggtgaagtcctgactgcgttcgctc gtacctccgtgaccacttctcgccacatggtacgttccatctccagcggt aaatccgctcagttccctgttctgggtcgcactcaggcagcgtatctggc tccgggcgagaacctcgacgataaacgtaaggacatcaaacacaccgaga aggtaatcaccattgacggtctcctgacggctgacgttctgatttatgat attgaggacgcgatgaaccactacgacgttcgctctgagtatacctctca gttgggtgaatctctggcgatggctgcggatggtgcggttctggctgaga ttgccggtctgtgtaacgtggaaagcaaatataatgagaacatcgagggc ttaggtactgctaccgtaattgagaccactcagaacaaggccgcacttac cgaccaagttgcgctgggtaaggagattattgcggctctgactaaggctc gtgcggctctgaccaagaactatgttccggctgctgaccgtgtgttctac tgtgacccagatagctactctgcgattctggcagcactgatgccgaacgc agcaaactacgctgctctgattgaccctgagaagggttctatccgcaacg ttatgggctttgaggttgtagaagttccgcacctcaccgctggtggtgct ggtaccgctcgtgagggcactactggtcagaagcacgtcttccctgccaa taaaggtgagggtaatgtcaaggttgctaaggacaacgttatcggcctgt tcatgcaccgctctgcggtaggtactgttaagctgcgtgacttggctctg gagcgcgctcgccgtgctaacttccaagcggaccagattatcgctaagta cgcaatgggccacggtggtcttcgcccagaagctgctggtgcagtggttt tcaaagtggagtaatgctgggggtggcctcaacggtcgctgctagtcccg aagaggcgagtgttacttcaacagaagaaaccttaacgccagcacaggag gccgcacgcacccgcgctgctaacaaagcccgaaaggaagctgagttggc tgctgccaccgctgagcaataactagcataaccccttggggcctctaaac gggtcttgaggggttttttgctgaaaggaggaactatatgcgctcatacg atatgaacgttgagactgccgctgagttatcagctgtgaacgacattctg gcgtctatcggtgaacctccggtatcaacgctggaaggtgacgctaacgc agatgcagcgaacgctcggcgtattctcaacaagattaaccgacagattc aatctcgtggatggacgttcaacattgaggaaggcataacgctactacct gatgtttactccaacctgattgtatacagtgacgactatttatccctaat gtctacttccggtcaatccatctacgttaaccgaggtggctatgtgtatg accgaacgagtcaatcagaccgctttgactctggtattactgtgaacatt attcgtctccgcgactacgatgagatgcctgagtgcttccgttactggat tgtcaccaaggcttcccgtcagttcaacaaccgattctttggggcaccgg aagtagagggtgtactccaagaagaggaagatgaggctagacgtctctgc atggagtatgagatggactacggtgggtacaatatgctggatggagatgc gttcacttctggtctactgactcgctaacattaataaataaggaggctct aatggcactcattagccaatcaatcaagaacttgaagggtggtatcagcc aacagcctgacatccttcgttatccagaccaagggtcacgccaagttaac ggttggtcttcggagaccgagggcctccaaaagcgtccacctcttgtttt cttaaatacacttggagacaacggtgcgttaggtcaagctccgtacatcc acctgattaaccgagatgagcacgaacagtattacgctgtgttcactggt agcggaatccgagtgttcgacctttctggtaacgagaagcaagttaggta tcctaacggttccaactacatcaagaccgctaatccacgtaacgacctgc gaatggttactgtagcagactatacgttcatcgttaaccgtaacgttgtt gcacagaagaacacaaagtctgtcaacttaccgaattacaaccctaatca agacggattgattaacgttcgtggtggtcagtatggtagggaactaattg tacacattaacggtaaagacgttgcgaagtataagataccagatggtagt caacctgaacacgtaaacaatacggatgcccaatggttagctgaagagtt agccaagcagatgcgcactaacttgtctgattggactgtaaatgtagggc aagggttcatccatgtgaccgcacctagtggtcaacagattgactccttc acgactaaagatggctacgcagaccagttgattaaccctgtgacccacta cgctcagtcgttctctaagctgccacctaatgctcctaacggctacatgg tgaaaatcgtaggggacgcctctaagtctgccgaccagtattacgttcgg tatgacgctgagcggaaagtttggactgagactttaggttggaacactga ggaccaagttctatgggaaaccatgccacacgctcttgtgcgagccgctg acggtaatttcgacttcaagtggcttgagtggtctcctaagtcttgtggt gacgttgacaccaacccttggccttcttttgttggttcaagtattaacga tgtgttcttcttccgtaaccgcttaggattccttagtggggagaacatca tattgagtcgtacagccaaatacttcaacttctaccctgcgtccattgcg aaccttagtgatgacgaccctatagacgtagctgtgagtaccaaccgaat agcaatccttaagtacgccgttccgttctcagaagagttactcatctggt ccgatgaagcacaattcgtcctgactgcctcgggtactctcacatctaag tcggttgagttgaacctaacgacccagtttgacgtacaggaccgagcgag accttttgggattgggcgtaatgtctactttgctagtccgaggtccagct tcacgtccatccacaggtactacgctgtgcaggatgtcagttccgttaag aatgctgaggacattacatcacacgttcctaactacatccctaatggtgt gttcagtatttgcggaagtggtacggaaaacttctgttcggtactatctc acggggaccctagtaaaatcttcatgtacaaattcctgtacctgaacgaa gagttaaggcaacagtcgtggtctcattgggactttggggaaaacgtaca ggttctagcttgtcagagtatcagctcagatatgtatgtgattcttcgca atgagttcaatacgttcctagctagaatctctttcactaagaacgccatt gacttacagggagaaccctatcgtgcctttatggacatgaagattcgata cacgattcctagtggaacatacaacgatgacacattcactacctctattc atattccaacaatttatggtgcaaacttcgggaggggcaaaatcactgta ttggagcctgatggtaagataaccgtgtttgagcaacctacggctgggtg gaatagcgacccttggctgagactcagcggtaacttggagggacgcatgg tgtacattgggttcaacattaacttcgtatatgagttctctaagttcctc atcaagcagactgccgacgacgggtctacctccacggaagacattgggcg cttacagttacgccgagcgtgggttaactacgagaactctggtacgtttg acatttatgttgagaaccaatcgtctaactggaagtacacaatggctggt gcccgattaggctctaacactctgagggctgggagactgaacttagggac cggacaatatcgattccctgtggttggtaacgccaagttcaacactgtat acatcttgtcagatgagactacccctctgaacatcattgggtgtggctgg gaaggtaactacttacggagaagttccggtatttaattaaatattctccc tgtggtggctcgaaattaatacgactcactatagggagaacaatacgact acgggagggttttcttatgatgactataagacctactaaaagtacagact ttgaggtattcactccggctcaccatgacattcttgaagctaaggctgct ggtattgagccgagtttccctgatgcttccgagtgtgtcacgttgagcct ctatgggttccctctagctatcggtggtaactgcggggaccagtgctggt tcgttacgagcgaccaagtgtggcgacttagtggaaaggctaagcgaaag ttccgtaagttaatcatggagtatcgcgataagatgcttgagaagtatga tactctttggaattacgtatgggtaggcaatacgtcccacattcgtttcc tcaagactatcggtgcggtattccatgaagagtacacacgagatggtcaa tttcagttatttacaatcacgaaaggaggataaccatatgtgttgggcag ccgcaatacctatcgctatatctggcgctcaggctatcagtggtcagaac gctcaggccaaaatgattgccgctcagaccgctgctggtcgtcgtcaagc tatggaaatcatgaggcagacgaacatccagaatgctgacctatcgttgc aagctcgaagtaaacttgaggaagcgtccgccgagttgacctcacagaac atgcagaaggtccaagctattgggtctatccgagcggctatcggagagag tatgcttgaaggttcctcaatggaccgcattaagcgagtcacagaaggac agttcattcgggaagccaatatggtaactgagaactatcgccgtgactac caagcaatcttcgcacagcaacttggtggtactcaaagtgctgcaagtca gattgacgaaatctataagagcgaacagaaacagaagagtaagctacaga tggttctggacccactggctatcatggggtcttccgctgcgagtgcttac gcatccggtgcgttcgactctaagtccacaactaaggcacctattgttgc cgctaaaggaaccaagacggggaggtaatgagctatgagtaaaattgaat ctgcccttcaagcggcacaaccgggactctctcggttacgtggtggtgct ggaggtatgggctatcgtgcagcaaccactcaggccgaacagccaaggtc aagcctattggacaccattggtcggttcgctaaggctggtgccgatatgt ataccgctaaggaacaacgagcacgagacctagctgatgaacgctctaac gagattatccgtaagctgacccctgagcaacgtcgagaagctctcaacaa cgggacccttctgtatcaggatgacccatacgctatggaagcactccgag tcaagactggtcgtaacgctgcgtatcttgtggacgatgacgttatgcag aagataaaagagggtgtcttccgtactcgcgaagagatggaagagtatcg ccatagtcgccttcaagagggcgctaaggtatacgctgagcagttcggca tcgaccctgaggacgttgattatcagcgtggtttcaacggggacattacc gagcgtaacatctcgctgtatggtgcgcatgataacttcttgagccagca agctcagaagggcgctatcatgaacagccgagtggaactcaacggtgtcc ttcaagaccctgatatgctgcgtcgtccagactctgctgacttctttgag aagtatatcgacaacggtctggttactggcgcaatcccatctgatgctca agccacacagcttataagccaagcgttcagtgacgcttctagccgtgctg gtggtgctgacttcctgatgcgagtcggtgacaagaaggtaacacttaac ggagccactacgacttaccgagagttgattggtgaggaacagtggaacgc tctcatggtcacagcacaacgttctcagtttgagactgacgcgaagctga acgagcagtatcgcttgaagattaactctgcgctgaaccaagaggaccca aggacagcttgggagatgcttcaaggtatcaaggctgaactagataaggt ccaacctgatgagcagatgacaccacaacgtgagtggctaatctccgcac aggaacaagttcagaatcagatgaacgcatggacgaaagctcaggccaag gctctggacgattccatgaagtcaatgaacaaacttgacgtaatcgacaa gcaattccagaagcgaatcaacggtgagtgggtctcaacggattttaagg atatgccagtcaacgagaacactggtgagttcaagcatagcgatatggtt aactacgccaataagaagctcgctgagattgacagtatggacattccaga cggtgccaaggatgctatgaagttgaagtaccttcaagcggactctaagg acggagcattccgtacagccatcggaaccatggtcactgacgctggtcaa gagtggtctgccgctgtgattaacggtaagttaccagaacgaaccccagc tatggatgctctgcgcagaatccgcaatgctgaccctcagttgattgctg cgctatacccagaccaagctgagctattcctgacgatggacatgatggac aagcagggtattgaccctcaggttattcttgatgccgaccgactgactgt taagcggtccaaagagcaacgctttgaggatgataaagcattcgagtctg cactgaatgcatctaaggctcctgagattgcccgtatgccagcgtcactg cgcgaatctgcacgtaagatttatgactccgttaagtatcgctcggggaa cgaaagcatggctatggagcagatgaccaagttccttaaggaatctacct acacgttcactggtgatgatgttgacggtgataccgttggtgtgattcct aagaatatgatgcaggttaactctgacccgaaatcatgggagcaaggtcg ggatattctggaggaagcacgtaagggaatcattgcgagcaacccttgga taaccaataagcaactgaccatgtattctcaaggtgactccatttacctt atggacaccacaggtcaagtcagagtccgatacgacaaagagttactctc gaaggtctggagtgagaaccagaagaaactcgaagagaaagctcgtgaga aggctctggctgatgtgaacaagcgagcacctatagttgccgctacgaag gcccgtgaagctgctgctaaacgagtccgagagaaacgtaaacagactcc taagttcatctacggacgtaaggagtaactaaaggctacataaggaggcc ctaaatggataagtacgataagaacgtaccaagtgattatgatggtctgt tccaaaaggctgctgatgccaacggggtctcttatgaccttttacgtaaa gtcgcttggacagaatcacgatttgtgcctacagcaaaatctaagactgg accattaggcatgatgcaatttaccaaggcaaccgctaaggccctcggtc tgcgagttaccgatggtccagacgacgaccgactgaaccctgagttagct attaatgctgccgctaagcaacttgcaggtctggtagggaagtttgatgg cgatgaactcaaagctgcccttgcgtacaaccaaggcgagggacgcttgg gtaatccacaacttgaggcgtactctaagggagacttcgcatcaatctct gaggagggacgtaactacatgcgtaaccttctggatgttgctaagtcacc tatggctggacagttggaaacttttggtggcataaccccaaagggtaaag gcattccggctgaggtaggattggctggaattggtcacaagcagaaagta acacaggaacttcctgagtccacaagttttgacgttaagggtatcgaaca ggaggctacggcgaaaccattcgccaaggacttttgggagacccacggag aaacacttgacgagtacaacagtcgttcaaccttcttcggattcaaaaat gctgccgaagctgaactctccaactcagtcgctgggatggctttccgtgc tggtcgtctcgataatggttttgatgtgtttaaagacaccattacgccga ctcgctggaactctcacatctggactccagaggagttagagaagattcga acagaggttaagaaccctgcgtacatcaacgttgtaactggtggttcccc tgagaacctcgatgacctcattaaattggctaacgagaactttgagaatg actcccgcgctgccgaggctggcctaggtgccaaactgagtgctggtatt attggtgctggtgtggacccgcttagctatgttcctatggtcggtgtcac tggtaagggctttaagttaatcaataaggctcttgtagttggtgccgaaa gtgctgctctgaacgttgcatccgaaggtctccgtacctccgtagctggt ggtgacgcagactatgcgggtgctgccttaggtggctttgtgtttggcgc aggcatgtctgcaatcagtgacgctgtagctgctggactgaaacgcagta aaccagaagctgagttcgacaatgagttcatcggtcctatgatgcgattg gaagcccgtgagacagcacgaaacgccaactctgcggacctctctcggat gaacactgagaacatgaagtttgaaggtgaacataatggtgtcccttatg aggacttaccaacagagagaggtgccgtggtgttacatgatggctccgtt ctaagtgcaagcaacccaatcaaccctaagactctaaaagagttctccga ggttgaccctgagaaggctgcgcgaggaatcaaactggctgggttcaccg agattggcttgaagaccttggggtctgacgatgctgacatccgtagagtg gctatcgacctcgttcgctctcctactggtatgcagtctggtgcctcagg taagttcggtgcaacagcttctgacatccatgagagacttcatggtactg accagcgtacttataatgacttgtacaaagcaatgtctgacgctatgaaa gaccctgagttctctactggcggcgctaagatgtcccgtgaagaaactcg atacactatctaccgtagagcggcactagctattgagcgtccagaactac agaaggcactcactccgtctgagagaatcgttatggacatcattaagcgt cactttgacaccaagcgtgaacttatggaaaacccagcaatattcggtaa cacaaaggctgtgagtatcttccctgagagtcgccacaaaggtacttacg ttcctcacgtatatgaccgtcatgccaaggcgctgatgattcaacgctac ggtgccgaaggtttgcaggaagggattgcccgctcatggatgaacagcta cgtctccagacctgaggtcaaggccagagtcgatgagatgcttaaggaat tacacggggtgaaggaagtaacaccagagatggtagagaagtacgctatg gataaggcttatggtatctcccactcagaccagttcaccaacagttccat aatagaagagaacattgagggcttagtaggtatcgagaataactcattcc ttgaggcacgtaacttgtttgattcggacctatccatcactatgccagac ggacagcaattctcagtgaatgacctaagggacttcgatatgttccgcat catgccagcgtatgaccgccgtgtcaatggtgacatcgccatcatggggt ctactggtaaaaccactaaggaacttaaggatgagattttggctctcaaa gcgaaagctgagggagacggtaagaagactggcgaggtacatgctttaat ggataccgttaagattcttactggtcgtgctagacgcaatcaggacactg tgtgggaaacctcactgcgtgccatcaatgacctagggttcttcgctaag aacgcctacatgggtgctcagaacattacggagattgctgggatgattgt cactggtaacgttcgtgctctagggcatggtatcccaattctgcgtgata cactctacaagtctaaaccagtttcagctaaggaactcaaggaactccat gcgtctctgttcgggaaggaggtggaccagttgattcggcctaaacgtgc tgacattgtgcagcgcctaagggaagcaactgataccggacctgccgtgg cgaacatcgtagggaccttgaagtattcaacacaggaactggctgctcgc tctccgtggactaagctactgaacggaaccactaactaccttctggatgc tgcgcgtcaaggtatgcttggggatgttattagtgccaccctaacaggta agactacccgctgggagaaagaaggcttccttcgtggtgcctccgtaact cctgagcagatggctggcatcaagtctctcatcaaggaacatatggtacg cggtgaggacgggaagtttaccgttaaggacaagcaagcgttctctatgg acccacgggctatggacttatggagactggctgacaaggtagctgatgag gcaatgctgcgtccacataaggtgtccttacaggattcccatgcgttcgg agcactaggtaagatggttatgcagtttaagtctttcactatcaagtccc ttaactctaagttcctgcgaaccttctatgatggatacaagaacaaccga gcgattgacgctgcgctgagcatcatcacctctatgggtctcgctggtgg tttctatgctatggctgcacacgtcaaagcatacgctctgcctaaggaga aacgtaaggagtacttggagcgtgcactggacccaaccatgattgcccac gctgcgttatctcgtagttctcaattgggtgctcctttggctatggttga cctagttggtggtgttttagggttcgagtcctccaagatggctcgctcta cgattctacctaaggacaccgtgaaggaacgtgacccaaacaaaccgtac acctctagagaggtaatgggcgctatgggttcaaaccttctggaacagat gccttcggctggctttgtggctaacgtaggggctaccttaatgaatgctg ctggcgtggtcaactcacctaataaagcaaccgagcaggacttcatgact ggtcttatgaactccacaaaagagttagtaccgaacgacccattgactca acagcttgtgttgaagatttatgaggcgaacggtgttaacttgagggagc gtaggaaataatacgactcactatagggagaggcgaaataatcttctccc tgtagtctcttagatttactttaaggaggtcaaatggctaacgtaattaa aaccgttttgacttaccagttagatggctccaatcgtgattttaatatcc cgtttgagtatctagcccgtaagttcgtagtggtaactcttattggtgta gaccgaaaggtccttacgattaatacagactatcgctttgctacacgtac tactatctctctgacaaaggcttggggtccagccgatggctacacgacca tcgagttacgtcgagtaacctccactaccgaccgattggttgactttacg gatggttcaatcctccgcgcgtatgaccttaacgtcgctcagattcaaac gatgcacgtagcggaagaggcccgtgacctcactacggatactatcggtg tcaataacgatggtcacttggatgctcgtggtcgtcgaattgtgaaccta gcgaacgccgtggatgaccgcgatgctgttccgtttggtcaactaaagac catgaaccagaactcatggcaagcacgtaatgaagccttacagttccgta atgaggctgagactttcagaaaccaagcggagggctttaagaacgagtcc agtaccaacgctacgaacacaaagcagtggcgcgatgagaccaagggttt ccgagacgaagccaagcggttcaagaatacggctggtcaatacgctacat ctgctgggaactctgcttccgctgcgcatcaatctgaggtaaacgctgag aactctgccacagcatccgctaactctgctcatttggcagaacagcaagc agaccgtgcggaacgtgaggcagacaagctggaaaattacaatggattgg ctggtgcaattgataaggtagatggaaccaatgtgtactggaaaggaaat attcacgctaacgggcgcctttacatgaccacaaacggttttgactgtgg ccagtatcaacagttctttggtggtgtcactaatcgttactctgtcatgg agtggggagatgagaacggatggctgatgtatgttcaacgtagagagtgg acaacagcgataggcggtaacatccagttagtagtaaacggacagatcat cacccaaggtggagccatgaccggtcagctaaaattgcagaatgggcatg ttcttcaattagagtccgcatccgacaaggcgcactatattctatctaaa gatggtaacaggaataactggtacattggtagagggtcagataacaacaa tgactgtaccttccactcctatgtacatggtacgaccttaacactcaagc aggactatgcagtagttaacaaacacttccacgtaggtcaggccgttgtg gccactgatggtaatattcaaggtactaagtggggaggtaaatggctgga tgcttacctacgtgacagcttcgttgcgaagtccaaggcgtggactcagg tgtggtctggtagtgctggcggtggggtaagtgtgactgtttcacaggat ctccgcttccgcaatatctggattaagtgtgccaacaactcttggaactt cttccgtactggccccgatggaatctacttcatagcctctgatggtggat ggttacgattccaaatacactccaacggtctcggattcaagaatattgca gacagtcgttcagtacctaatgcaatcatggtggagaacgagtaattggt aaatcacaaggaaagacgtgtagtccacggatggactctcaaggaggtac aaggtgctatcattagactttaacaacgaattgattaaggctgctccaat tgttgggacgggtgtagcagatgttagtgctcgactgttctttgggttaa gccttaacgaatggttctacgttgctgctatcgcctacacagtggttcag attggtgccaaggtagtcgataagatgattgactggaagaaagccaataa ggagtgatatgtatggaaaaggataagagccttattacattcttagagat gttggacactgcgatggctcagcgtatgcttgcggacctttcggaccatg agcgtcgctctccgcaactctataatgctattaacaaactgttagaccgc cacaagttccagattggtaagttgcagccggatgttcacatcttaggtgg ccttgctggtgctcttgaagagtacaaagagaaagtcggtgataacggtc ttacggatgatgatatttacacattacagtgatatactcaaggccactac agatagtggtctttatggatgtcattgtctatacgagatgctcctacgtg aaatctgaaagttaacgggaggcattatgctagaatttttacgtaagcta atcccttgggttctcgctgggatgctattcgggttaggatggcatctagg gtcagactcaatggacgctaaatggaaacaggaggtacacaatgagtacg ttaagagagttgaggctgcgaagagcactcaaagagcaatcgatgcggta tctgctaagtatcaagaagaccttgccgcgctggaagggagcactgatag gattatttctgatttgcgtagcgacaataagcggttgcgcgtcagagtca aaactaccggaacctccgatggtcagtgtggattcgagcctgatggtcga gccgaacttgacgaccgagatgctaaacgtattctcgcagtgacccagaa gggtgacgcatggattcgtgcgttacaggatactattcgtgaactgcaac gtaagtaggaaatcaagtaaggaggcaatgtgtctactcaatccaatcgt aatgcgctcgtagtggcgcaactgaaaggagacttcgtggcgttcctatt cgtcttatggaaggcgctaaacctaccggtgcccactaagtgtcagattg acatggctaaggtgctggcgaatggagacaacaagaagttcatcttacag gctttccgtggtatcggtaagtcgttcatcacatgtgcgttcgttgtgtg gtccttatggagagaccctcagttgaagatacttatcgtatcagcctcta aggagcgtgcagacgctaactccatctttattaagaacatcattgacctg ctgccattcctatctgagttaaagccaagacccggacagcgtgactcggt aatcagctttgatgtaggcccagccaatcctgaccactctcctagtgtga aatcagtaggtatcactggtcagttaactggtagccgtgctgacattatc attgcggatgacgttgagattccgtctaacagcgcaactatgggtgcccg tgagaagctatggactctggttcaggagttcgctgcgttacttaaaccgc tgccttcctctcgcgttatctaccttggtacacctcagacagagatgact ctctataaggaacttgaggataaccgtgggtacacaaccattatctggcc tgctctgtacccaaggacacgtgaagagaacctctattactcacagcgtc ttgctcctatgttacgcgctgagtacgatgagaaccctgaggcacttgct gggactccaacagacccagtgcgctttgaccgtgatgacctgcgcgagcg tgagttggaatacggtaaggctggctttacgctacagttcatgcttaacc ctaaccttagtgatgccgagaagtacccgctgaggcttcgtgacgctatc gtagcggccttagacttagagaaggccccaatgcattaccagtggcttcc gaaccgtcagaacatcattgaggaccttcctaacgttggccttaagggtg atgacctgcatacgtaccacgattgttccaacaactcaggtcagtaccaa cagaagattctggtcattgaccctagtggtcgcggtaaggacgaaacagg ttacgctgtgctgtacacactgaacggttacatctaccttatggaagctg gaggtttccgtgatggctactccgataagacccttgagttactcgctaag aaggcaaagcaatggggagtccagacggttgtctacgagagtaacttcgg tgacggtatgttcggtaaggtattcagtcctatccttcttaaacaccaca actgtgcgatggaagagattcgtgcccgtggtatgaaagagatgcgtatt tgcgatacccttgagccagtcatgcagactcaccgccttgtaattcgtga tgaggtcattagggccgactaccagtccgctcgtgacgtagacggtaagc atgacgttaagtactcgttgttctaccagatgacccgtatcactcgtgag aaaggcgctctggctcatgatgaccgattggatgcccttgcgttaggcat tgagtatctccgtgagtccatgcagttggattccgttaaggtcgagggtg aagtacttgctgacttccttgaggaacacatgatgcgtcctacggttgct gctacgcatatcattgagatgtctgtgggaggagttgatgtgtactctga ggacgatgagggttacggtacgtctttcattgagtggtgatttatgcatt aggactgcatagggatgcactatagaccacggatggtcagttctttaagt tactgaaaagacacgataaattaatacgactcactatagggagaggaggg acgaaaggttactatatagatactgaatgaatacttatagagtgcataaa gtatgcataatggtgtacctagagtgacctctaagaatggtgattatatt gtattagtatcaccttaacttaaggaccaacataaagggaggagactcat gttccgcttattgttgaacctactgcggcatagagtcacctaccgatttc ttgtggtactttgtgctgcccttgggtacgcatctcttactggagacctc agttcactggagtctgtcgtttgctctatactcacttgtagcgattaggg tcttcctgaccgactgatggctcaccgagggattcagcggtatgattgca tcacaccacttcatccctatagagtcaagtcctaaggtatacccataaag agcctctaatggtctatcctaaggtctatacctaaagataggccatccta tcagtgtcacctaaagagggtcttagagagggcctatggagttcctatag ggtcctttaaaatataccataaaaatctgagtgactatctcacagtgtac ggacctaaagttcccccatagggggtacctaaagcccagccaatcaccta aagtcaaccttcggttgaccttgagggttccctaagggttggggatgacc cttgggtttgtctttgggtgttaccttgagtgtctctctgtgtccct



Back to Vector page
Back to Homepage