Phage Lambda

- Reference:

Sanger et al. 1982 J. Mol. Biol. 162: 729-773


GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAA GGCGTTTCCGTTCTTCTTCGTCATAACTTAATGTTTTTATTTAAAATACC CTCTGAAAAGAAAGGAAACGACAGGTGCTGAAAGCGAGGCTTTTTGGCCT CTGTCGTTTCCTTTCTCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCA ACAAAAAGCAGCTGGCTGACATTTTCGGTGCGAGTATCCGTACCATTCAG AACTGGCAGGAACAGGGAATGCCCGTTCTGCGAGGCGGTGGCAAGGGTAA TGAGGTGCTTTATGACTCTGCCGCCGTCATAAAATGGTATGCCGAAAGGG ATGCTGAAATTGAGAACGAAAAGCTGCGCCGGGAGGTTGAAGAACTGCGG CAGGCCAGCGAGGCAGATCTCCAGCCAGGAACTATTGAGTACGAACGCCA TCGACTTACGCGTGCGCAGGCCGACGCACAGGAACTGAAGAATGCCAGAG ACTCCGCTGAAGTGGTGGAAACCGCATTCTGTACTTTCGTGCTGTCGCGG ATCGCAGGTGAAATTGCCAGTATTCTCGACGGGCTCCCCCTGTCGGTGCA GCGGCGTTTTCCGGAACTGGAAAACCGACATGTTGATTTCCTGAAACGGG ATATCATCAAAGCCATGAACAAAGCAGCCGCGCTGGATGAACTGATACCG GGGTTGCTGAGTGAATATATCGAACAGTCAGGTTAACAGGCTGCGGCATT TTGTCCGCGCCGGGCTTCGCTCACTGTTCAGGCCGGAGCCACAGACCGCC GTTGAATGGGCGGATGCTAATTACTATCTCCCGAAAGAATCCGCATACCA GGAAGGGCGCTGGGAAACACTGCCCTTTCAGCGGGCCATCATGAATGCGA TGGGCAGCGACTACATCCGTGAGGTGAATGTGGTGAAGTCTGCCCGTGTC GGTTATTCCAAAATGCTGCTGGGTGTTTATGCCTACTTTATAGAGCATAA GCAGCGCAACACCCTTATCTGGTTGCCGACGGATGGTGATGCCGAGAACT TTATGAAAACCCACGTTGAGCCGACTATTCGTGATATTCCGTCGCTGCTG GCGCTGGCCCCGTGGTATGGCAAAAAGCACCGGGATAACACGCTCACCAT GAAGCGTTTCACTAATGGGCGTGGCTTCTGGTGCCTGGGCGGTAAAGCGG CAAAAAACTACCGTGAAAAGTCGGTGGATGTGGCGGGTTATGATGAACTT GCTGCTTTTGATGATGATATTGAACAGGAAGGCTCTCCGACGTTCCTGGG TGACAAGCGTATTGAAGGCTCGGTCTGGCCAAAGTCCATCCGTGGCTCCA CGCCAAAAGTGAGAGGCACCTGTCAGATTGAGCGTGCAGCCAGTGAATCC CCGCATTTTATGCGTTTTCATGTTGCCTGCCCGCATTGCGGGGAGGAGCA GTATCTTAAATTTGGCGACAAAGAGACGCCGTTTGGCCTCAAATGGACGC CGGATGACCCCTCCAGCGTGTTTTATCTCTGCGAGCATAATGCCTGCGTC ATCCGCCAGCAGGAGCTGGACTTTACTGATGCCCGTTATATCTGCGAAAA GACCGGGATCTGGACCCGTGATGGCATTCTCTGGTTTTCGTCATCCGGTG AAGAGATTGAGCCACCTGACAGTGTGACCTTTCACATCTGGACAGCGTAC AGCCCGTTCACCACCTGGGTGCAGATTGTCAAAGACTGGATGAAAACGAA AGGGGATACGGGAAAACGTAAAACCTTCGTAAACACCACGCTCGGTGAGA CGTGGGAGGCGAAAATTGGCGAACGTCCGGATGCTGAAGTGATGGCAGAG CGGAAAGAGCATTATTCAGCGCCCGTTCCTGACCGTGTGGCTTACCTGAC CGCCGGTATCGACTCCCAGCTGGACCGCTACGAAATGCGCGTATGGGGAT GGGGGCCGGGTGAGGAAAGCTGGCTGATTGACCGGCAGATTATTATGGGC CGCCACGACGATGAACAGACGCTGCTGCGTGTGGATGAGGCCATCAATAA AACCTATACCCGCCGGAATGGTGCAGAAATGTCGATATCCCGTATCTGCT GGGATACTGGCGGGATTGACCCGACCATTGTGTATGAACGCTCGAAAAAA CATGGGCTGTTCCGGGTGATCCCCATTAAAGGGGCATCCGTCTACGGAAA GCCGGTGGCCAGCATGCCACGTAAGCGAAACAAAAACGGGGTTTACCTTA CCGAAATCGGTACGGATACCGCGAAAGAGCAGATTTATAACCGCTTCACA CTGACGCCGGAAGGGGATGAACCGCTTCCCGGTGCCGTTCACTTCCCGAA TAACCCGGATATTTTTGATCTGACCGAAGCGCAGCAGCTGACTGCTGAAG AGCAGGTCGAAAAATGGGTGGATGGCAGGAAAAAAATACTGTGGGACAGC AAAAAGCGACGCAATGAGGCACTCGACTGCTTCGTTTATGCGCTGGCGGC GCTGCGCATCAGTATTTCCCGCTGGCAGCTGGATCTCAGTGCGCTGCTGG CGAGCCTGCAGGAAGAGGATGGTGCAGCAACCAACAAGAAAACACTGGCA GATTACGCCCGTGCCTTATCCGGAGAGGATGAATGACGCGACAGGAAGAA CTTGCCGCTGCCCGTGCGGCACTGCATGACCTGATGACAGGTAAACGGGT GGCAACAGTACAGAAAGACGGACGAAGGGTGGAGTTTACGGCCACTTCCG TGTCTGACCTGAAAAAATATATTGCAGAGCTGGAAGTGCAGACCGGCATG ACACAGCGACGCAGGGGACCTGCAGGATTTTATGTATGAAAACGCCCACC ATTCCCACCCTTCTGGGGCCGGACGGCATGACATCGCTGCGCGAATATGC CGGTTATCACGGCGGTGGCAGCGGATTTGGAGGGCAGTTGCGGTCGTGGA ACCCACCGAGTGAAAGTGTGGATGCAGCCCTGTTGCCCAACTTTACCCGT GGCAATGCCCGCGCAGACGATCTGGTACGCAATAACGGCTATGCCGCCAA CGCCATCCAGCTGCATCAGGATCATATCGTCGGGTCTTTTTTCCGGCTCA GTCATCGCCCAAGCTGGCGCTATCTGGGCATCGGGGAGGAAGAAGCCCGT GCCTTTTCCCGCGAGGTTGAAGCGGCATGGAAAGAGTTTGCCGAGGATGA CTGCTGCTGCATTGACGTTGAGCGAAAACGCACGTTTACCATGATGATTC GGGAAGGTGTGGCCATGCACGCCTTTAACGGTGAACTGTTCGTTCAGGCC ACCTGGGATACCAGTTCGTCGCGGCTTTTCCGGACACAGTTCCGGATGGT CAGCCCGAAGCGCATCAGCAACCCGAACAATACCGGCGACAGCCGGAACT GCCGTGCCGGTGTGCAGATTAATGACAGCGGTGCGGCGCTGGGATATTAC GTCAGCGAGGACGGGTATCCTGGCTGGATGCCGCAGAAATGGACATGGAT ACCCCGTGAGTTACCCGGCGGGCGCGCCTCGTTCATTCACGTTTTTGAAC CCGTGGAGGACGGGCAGACTCGCGGTGCAAATGTGTTTTACAGCGTGATG GAGCAGATGAAGATGCTCGACACGCTGCAGAACACGCAGCTGCAGAGCGC CATTGTGAAGGCGATGTATGCCGCCACCATTGAGAGTGAGCTGGATACGC AGTCAGCGATGGATTTTATTCTGGGCGCGAACAGTCAGGAGCAGCGGGAA AGGCTGACCGGCTGGATTGGTGAAATTGCCGCGTATTACGCCGCAGCGCC GGTCCGGCTGGGAGGCGCAAAAGTACCGCACCTGATGCCGGGTGACTCAC TGAACCTGCAGACGGCTCAGGATACGGATAACGGCTACTCCGTGTTTGAG CAGTCACTGCTGCGGTATATCGCTGCCGGGCTGGGTGTCTCGTATGAGCA GCTTTCCCGGAATTACGCCCAGATGAGCTACTCCACGGCACGGGCCAGTG CGAACGAGTCGTGGGCGTACTTTATGGGGCGGCGAAAATTCGTCGCATCC CGTCAGGCGAGCCAGATGTTTCTGTGCTGGCTGGAAGAGGCCATCGTTCG CCGCGTGGTGACGTTACCTTCAAAAGCGCGCTTCAGTTTTCAGGAAGCCC GCAGTGCCTGGGGGAACTGCGACTGGATAGGCTCCGGTCGTATGGCCATC GATGGTCTGAAAGAAGTTCAGGAAGCGGTGATGCTGATAGAAGCCGGACT GAGTACCTACGAGAAAGAGTGCGCAAAACGCGGTGACGACTATCAGGAAA TTTTTGCCCAGCAGGTCCGTGAAACGATGGAGCGCCGTGCAGCCGGTCTT AAACCGCCCGCCTGGGCGGCTGCAGCATTTGAATCCGGGCTGCGACAATC AACAGAGGAGGAGAAGAGTGACAGCAGAGCTGCGTAATCTCCCGCATATT GCCAGCATGGCCTTTAATGAGCCGCTGATGCTTGAACCCGCCTATGCGCG GGTTTTCTTTTGTGCGCTTGCAGGCCAGCTTGGGATCAGCAGCCTGACGG ATGCGGTGTCCGGCGACAGCCTGACTGCCCAGGAGGCACTCGCGACGCTG GCATTATCCGGTGATGATGACGGACCACGACAGGCCCGCAGTTATCAGGT CATGAACGGCATCGCCGTGCTGCCGGTGTCCGGCACGCTGGTCAGCCGGA CGCGGGCGCTGCAGCCGTACTCGGGGATGACCGGTTACAACGGCATTATC GCCCGTCTGCAACAGGCTGCCAGCGATCCGATGGTGGACGGCATTCTGCT CGATATGGACACGCCCGGCGGGATGGTGGCGGGGGCATTTGACTGCGCTG ACATCATCGCCCGTGTGCGTGACATAAAACCGGTATGGGCGCTTGCCAAC GACATGAACTGCAGTGCAGGTCAGTTGCTTGCCAGTGCCGCCTCCCGGCG TCTGGTCACGCAGACCGCCCGGACAGGCTCCATCGGCGTCATGATGGCTC ACAGTAATTACGGTGCTGCGCTGGAGAAACAGGGTGTGGAAATCACGCTG ATTTACAGCGGCAGCCATAAGGTGGATGGCAACCCCTACAGCCATCTTCC GGATGACGTCCGGGAGACACTGCAGTCCCGGATGGACGCAACCCGCCAGA TGTTTGCGCAGAAGGTGTCGGCATATACCGGCCTGTCCGTGCAGGTTGTG CTGGATACCGAGGCTGCAGTGTACAGCGGTCAGGAGGCCATTGATGCCGG ACTGGCTGATGAACTTGTTAACAGCACCGATGCGATCACCGTCATGCGTG ATGCACTGGATGCACGTAAATCCCGTCTCTCAGGAGGGCGAATGACCAAA GAGACTCAATCAACAACTGTTTCAGCCACTGCTTCGCAGGCTGACGTTAC TGACGTGGTGCCAGCGACGGAGGGCGAGAACGCCAGCGCGGCGCAGCCGG ACGTGAACGCGCAGATCACCGCAGCGGTTGCGGCAGAAAACAGCCGCATT ATGGGGATCCTCAACTGTGAGGAGGCTCACGGACGCGAAGAACAGGCACG CGTGCTGGCAGAAACCCCCGGTATGACCGTGAAAACGGCCCGCCGCATTC TGGCCGCAGCACCACAGAGTGCACAGGCGCGCAGTGACACTGCGCTGGAT CGTCTGATGCAGGGGGCACCGGCACCGCTGGCTGCAGGTAACCCGGCATC TGATGCCGTTAACGATTTGCTGAACACACCAGTGTAAGGGATGTTTATGA CGAGCAAAGAAACCTTTACCCATTACCAGCCGCAGGGCAACAGTGACCCG GCTCATACCGCAACCGCGCCCGGCGGATTGAGTGCGAAAGCGCCTGCAAT GACCCCGCTGATGCTGGACACCTCCAGCCGTAAGCTGGTTGCGTGGGATG GCACCACCGACGGTGCTGCCGTTGGCATTCTTGCGGTTGCTGCTGACCAG ACCAGCACCACGCTGACGTTCTACAAGTCCGGCACGTTCCGTTATGAGGA TGTGCTCTGGCCGGAGGCTGCCAGCGACGAGACGAAAAAACGGACCGCGT TTGCCGGAACGGCAATCAGCATCGTTTAACTTTACCCTTCATCACTAAAG GCCGCCTGTGCGGCTTTTTTTACGGGATTTTTTTATGTCGATGTACACAA CCGCCCAACTGCTGGCGGCAAATGAGCAGAAATTTAAGTTTGATCCGCTG TTTCTGCGTCTCTTTTTCCGTGAGAGCTATCCCTTCACCACGGAGAAAGT CTATCTCTCACAAATTCCGGGACTGGTAAACATGGCGCTGTACGTTTCGC CGATTGTTTCCGGTGAGGTTATCCGTTCCCGTGGCGGCTCCACCTCTGAA TTTACGCCGGGATATGTCAAGCCGAAGCATGAAGTGAATCCGCAGATGAC CCTGCGTCGCCTGCCGGATGAAGATCCGCAGAATCTGGCGGACCCGGCTT ACCGCCGCCGTCGCATCATCATGCAGAACATGCGTGACGAAGAGCTGGCC ATTGCTCAGGTCGAAGAGATGCAGGCAGTTTCTGCCGTGCTTAAGGGCAA ATACACCATGACCGGTGAAGCCTTCGATCCGGTTGAGGTGGATATGGGCC GCAGTGAGGAGAATAACATCACGCAGTCCGGCGGCACGGAGTGGAGCAAG CGTGACAAGTCCACGTATGACCCGACCGACGATATCGAAGCCTACGCGCT GAACGCCAGCGGTGTGGTGAATATCATCGTGTTCGATCCGAAAGGCTGGG CGCTGTTCCGTTCCTTCAAAGCCGTCAAGGAGAAGCTGGATACCCGTCGT GGCTCTAATTCCGAGCTGGAGACAGCGGTGAAAGACCTGGGCAAAGCGGT GTCCTATAAGGGGATGTATGGCGATGTGGCCATCGTCGTGTATTCCGGAC AGTACGTGGAAAACGGCGTCAAAAAGAACTTCCTGCCGGACAACACGATG GTGCTGGGGAACACTCAGGCACGCGGTCTGCGCACCTATGGCTGCATTCA GGATGCGGACGCACAGCGCGAAGGCATTAACGCCTCTGCCCGTTACCCGA AAAACTGGGTGACCACCGGCGATCCGGCGCGTGAGTTCACCATGATTCAG TCAGCACCGCTGATGCTGCTGGCTGACCCTGATGAGTTCGTGTCCGTACA ACTGGCGTAATCATGGCCCTTCGGGGCCATTGTTTCTCTGTGGAGGAGTC CATGACGAAAGATGAACTGATTGCCCGTCTCCGCTCGCTGGGTGAACAAC TGAACCGTGATGTCAGCCTGACGGGGACGAAAGAAGAACTGGCGCTCCGT GTGGCAGAGCTGAAAGAGGAGCTTGATGACACGGATGAAACTGCCGGTCA GGACACCCCTCTCAGCCGGGAAAATGTGCTGACCGGACATGAAAATGAGG TGGGATCAGCGCAGCCGGATACCGTGATTCTGGATACGTCTGAACTGGTC ACGGTCGTGGCACTGGTGAAGCTGCATACTGATGCACTTCACGCCACGCG GGATGAACCTGTGGCATTTGTGCTGCCGGGAACGGCGTTTCGTGTCTCTG CCGGTGTGGCAGCCGAAATGACAGAGCGCGGCCTGGCCAGAATGCAATAA CGGGAGGCGCTGTGGCTGATTTCGATAACCTGTTCGATGCTGCCATTGCC CGCGCCGATGAAACGATACGCGGGTACATGGGAACGTCAGCCACCATTAC ATCCGGTGAGCAGTCAGGTGCGGTGATACGTGGTGTTTTTGATGACCCTG AAAATATCAGCTATGCCGGACAGGGCGTGCGCGTTGAAGGCTCCAGCCCG TCCCTGTTTGTCCGGACTGATGAGGTGCGGCAGCTGCGGCGTGGAGACAC GCTGACCATCGGTGAGGAAAATTTCTGGGTAGATCGGGTTTCGCCGGATG ATGGCGGAAGTTGTCATCTCTGGCTTGGACGGGGCGTACCGCCTGCCGTT AACCGTCGCCGCTGAAAGGGGGATGTATGGCCATAAAAGGTCTTGAGCAG GCCGTTGAAAACCTCAGCCGTATCAGCAAAACGGCGGTGCCTGGTGCCGC CGCAATGGCCATTAACCGCGTTGCTTCATCCGCGATATCGCAGTCGGCGT CACAGGTTGCCCGTGAGACAAAGGTACGCCGGAAACTGGTAAAGGAAAGG GCCAGGCTGAAAAGGGCCACGGTCAAAAATCCGCAGGCCAGAATCAAAGT TAACCGGGGGGATTTGCCCGTAATCAAGCTGGGTAATGCGCGGGTTGTCC TTTCGCGCCGCAGGCGTCGTAAAAAGGGGCAGCGTTCATCCCTGAAAGGT GGCGGCAGCGTGCTTGTGGTGGGTAACCGTCGTATTCCCGGCGCGTTTAT TCAGCAACTGAAAAATGGCCGGTGGCATGTCATGCAGCGTGTGGCTGGGA AAAACCGTTACCCCATTGATGTGGTGAAAATCCCGATGGCGGTGCCGCTG ACCACGGCGTTTAAACAAAATATTGAGCGGATACGGCGTGAACGTCTTCC GAAAGAGCTGGGCTATGCGCTGCAGCATCAACTGAGGATGGTAATAAAGC GATGAAACATACTGAACCTCCGTGCAGCCGtACTGGATGCACTGGAGAAG CATGACACCGGGGCGACGTTTTTTGATGGTCGCCCCGCTGTTTTTGATGA GGCGGATTTTCCGGCAGTTGCCGTTTATCTCACCGGCGCTGAATACACGG GCGAAGAGCTGGACAGCGATACCTGGCAGGCGGAGCTGCATATCGAAGTT TTCCTGCCTGCTCAGGTGCCGGATTCAGAGCTGGATGCGTGGATGGAGTC CCGGATTTATCCGGTGATGAGCGATATCCCGGCACTGTCAGATTTGATCA CCAGTATGGTGGCCAGCGGCTATGACTACCGGCGCGACGATGATGCGGGC TTGTGGAGTTCAGCCGATCTGACTTATGTCATTACCTATGAAATGTGAGG ACGCTATGCCTGTACCAAATCCTACAATGCCGGTGAAAGGTGCCGGGACC ACCCTGTGGGTTTATAAGGGGAGCGGTGACCCTTACGCGAATCCGCTTTC AGACGTTGACTGGTCGCGTCTGGCAAAAGTTAAAGACCTGACGCCCGGCG AACTGACCGCTGAGTCCTATGACGACAGCTATCTCGATGATGAAGATGCA GACTGGACTGCGACCGGGCAGGGGCAGAAATCTGCCGGAGATACCAGCTT CACGCTGGCGTGGATGCCCGGAGAGCAGGGGCAGCAGGCGCTGCTGGCGT GGTTTAATGAAGGCGATACCCGTGCCTATAAAATCCGCTTCCCGAACGGC ACGGTCGATGTGTTCCGTGGCTGGGTCAGCAGTATCGGTAAGGCGGTGAC GGCGAAGGAAGTGATCACCCGCACGGTGAAAGTCACCAATGTGGGACGTC CGTCGATGGCAGAAGATCGCAGCACGGTAACAGCGGCAACCGGCATGACC GTGACGCCTGCCAGCACCTCGGTGGTGAAAGGGCAGAGCACCACGCTGAC CGTGGCCTTCCAGCCGGAGGGCGTAACCGACAAGAGCTTTCGTGCGGTGT CTGCGGATAAAACAAAAGCCACCGTGTCGGTCAGTGGTATGACCATCACC GTGAACGGCGTTGCTGCAGGCAAGGTCAACATTCCGGTTGTATCCGGTAA TGGTGAGTTTGCTGCGGTTGCAGAAATTACCGTCACCGCCAGTTAATCCG GAGAGTCAGCGATGTTCCTGAAAACCGAATCATTTGAACATAACGGTGTG ACCGTCACGCTTTCTGAACTGTCAGCCCTGCAGCGCATTGAGCATCTCGC CCTGATGAAACGGCAGGCAGAACAGGCGGAGTCAGACAGCAACCGGAAGT TTACTGTGGAAGACGCCATCAGAACCGGCGCGTTTCTGGTGGCGATGTCC CTGTGGCATAACCATCCGCAGAAGACGCAGATGCCGTCCATGAATGAAGC CGTTAAACAGATTGAGCAGGAAGTGCTTACCACCTGGCCCACGGAGGCAA TTTCTCATGCTGAAAACGTGGTGTACCGGCTGTCTGGTATGTATGAGTTT GTGGTGAATAATGCCCCTGAACAGACAGAGGACGCCGGGCCCGCAGAGCC TGTTTCTGCGGGAAAGTGTTCGACGGTGAGCTGAGTTTTGCCCTGAAACT GGCGCGTGAGATGGGGCGACCCGACTGGCGTGCCATGCTTGCCGGGATGT CATCCACGGAGTATGCCGACTGGCACCGCTTTTACAGTACCCATTATTTT CATGATGTTCTGCTGGATATGCACTTTTCCGGGCTGACGTACACCGTGCT CAGCCTGTTTTTCAGCGATCCGGATATGCATCCGCTGGATTTCAGTCTGC TGAACCGGCGCGAGGCTGACGAAGAGCCTGAAGATGATGTGCTGATGCAG AAAGCGGCAGGGCTTGCCGGAGGTGTCCGCTTTGGCCCGGACGGGAATGA AGTTATCCCCGCTTCCCCGGATGTGGCGGACATGACGGAGGATGACGTAA TGCTGATGACAGTATCAGAAGGGATCGCAGGAGGAGTCCGGTATGGCTGA ACCGGTAGGCGATCTGGTCGTTGATTTGAGTCTGGATGCGGCCAGATTTG ACGAGCAGATGGCCAGAGTCAGGCGTCATTTTTCTGGTACGGAAAGTGAT GCGAAAAAAACAGCGGCAGTCGTTGAACAGTCGCTGAGCCGACAGGCGCT GGCTGCACAGAAAGCGGGGATTTCCGTCGGGCAGTATAAAGCCGCCATGC GTATGCTGCCTGCACAGTTCACCGACGTGGCCACGCAGCTTGCAGGCGGG CAAAGTCCGTGGCTGATCCTGCTGCAACAGGGGGGGCAGGTGAAGGACTC CTTCGGCGGGATGATCCCCATGTTCAGGGGGCTTGCCGGTGCGATCACCC TGCCGATGGTGGGGGCCACCTCGCTGGCGGTGGCGACCGGTGCGCTGGCG TATGCCTGGTATCAGGGCAACTCAACCCTGTCCGATTTCAACAAAACGCT GGTCCTTTCCGGCAATCAGGCGGGACTGACGGCAGATCGTATGCTGGTCC TGTCCAGAGCCGGGCAGGCGGCAGGGCTGACGTTTAACCAGACCAGCGAG TCACTCAGCGCACTGGTTAAGGCGGGGGTAAGCGGTGAGGCTCAGATTGC GTCCATCAGCCAGAGTGTGGCGCGTTTCTCCTCTGCATCCGGCGTGGAGG TGGACAAGGTCGCTGAAGCCTTCGGGAAGCTGACCACAGACCCGACGTCG GGGCTGACGGCGATGGCTCGCCAGTTCCATAACGTGTCGGCGGAGCAGAT TGCGTATGTTGCTCAGTTGCAGCGTTCCGGCGATGAAGCCGGGGCATTGC AGGCGGCGAACGAGGCCGCAACGAAAGGGTTTGATGACCAGACCCGCCGC CTGAAAGAGAACATGGGCACGCTGGAGACCTGGGCAGACAGGACTGCGCG GGCATTCAAATCCATGTGGGATGCGGTGCTGGATATTGGTCGTCCTGATA CCGCGCAGGAGATGCTGATTAAGGCAGAGGCTGCGTATAAGAAAGCAGAC GACATCTGGAATCTGCGCAAGGATGATTATTTTGTTAACGATGAAGCGCG GGCGCGTTACTGGGATGATCGTGAAAAGGCCCGTCTTGCGCTTGAAGCCG CCCGAAAGAAGGCTGAGCAGCAGACTCAACAGGACAAAAATGCGCAGCAG CAGAGCGATACCGAAGCGTCACGGCTGAAATATACCGAAGAGGCGCAGAA GGCTTACGAACGGCTGCAGACGCCGCTGGAGAAATATACCGCCCGTCAGG AAGAACTGAACAAGGCACTGAAAGACGGGAAAATCCTGCAGGCGGATTAC AACACGCTGATGGCGGCGGCGAAAAAGGATTATGAAGCGACGCTGAAAAA GCCGAAACAGTCCAGCGTGAAGGTGTCTGCGGGCGATCGTCAGGAAGACA GTGCTCATGCTGCCCTGCTGACGCTTCAGGCAGAACTCCGGACGCTGGAG AAGCATGCCGGAGCAAATGAGAAAATCAGCCAGCAGCGCCGGGATTTGTG GAAGGCGGAGAGTCAGTTCGCGGTACTGGAGGAGGCGGCGCAACGTCGCC AGCTGTCTGCACAGGAGAAATCCCTGCTGGCGCATAAAGATGAGACGCTG GAGTACAAACGCCAGCTGGCTGCACTTGGCGACAAGGTTACGTATCAGGA GCGCCTGAACGCGCTGGCGCAGCAGGCGGATAAATTCGCACAGCAGCAAC GGGCAAAACGGGCCGCCATTGATGCGAAAAGCCGGGGGCTGACTGACCGG CAGGCAGAACGGGAAGCCACGGAACAGCGCCTGAAGGAACAGTATGGCGA TAATCCGCTGGCGCTGAATAACGTCATGTCAGAGCAGAAAAAGACCTGGG CGGCTGAAGACCAGCTTCGCGGGAACTGGATGGCAGGCCTGAAGTCCGGC TGGAGTGAGTGGGAAGAGAGCGCCACGGACAGTATGTCGCAGGTAAAAAG TGCAGCCACGCAGACCTTTGATGGTATTGCACAGAATATGGCGGCGATGC TGACCGGCAGTGAGCAGAACTGGCGCAGCTTCACCCGTTCCGTGCTGTCC ATGATGACAGAAATTCTGCTTAAGCAGGCAATGGTGGGGATTGTCGGGAG TATCGGCAGCGCCATTGGCGGGGCTGTTGGTGGCGGCGCATCCGCGTCAG GCGGTACAGCCATTCAGGCCGCTGCGGCGAAATTCCATTTTGCAACCGGA GGATTTACGGGAACCGGCGGCAAATATGAGCCAGCGGGGATTGTTCACCG TGGTGAGTTTGTCTTCACGAAGGAGGCAACCAGCCGGATTGGCGTGGGGA ATCTTTACCGGCTGATGCGCGGCTATGCCACCGGCGGTTATGTCGGTACA CCGGGCAGCATGGCAGACAGCCGGTCGCAGGCGTCCGGGACGTTTGAGCA GAATAACCATGTGGTGATTAACAACGACGGCACGAACGGGCAGATAGGTC CGGCTGCTCTGAAGGCGGTGTATGACATGGCCCGCAAGGGTGCCCGTGAT GAAATTCAGACACAGATGCGTGATGGTGGCCTGTTCTCCGGAGGTGGACG ATGAAGACCTTCCGCTGGAAAGTGAAACCCGGTATGGATGTGGCTTCGGT CCCTTCTGTAAGAAAGGTGCGCTTTGGTGATGGCTATTCTCAGCGAGCGC CTGCCGGGCTGAATGCCAACCTGAAAACGTACAGCGTGACGCTTTCTGTC CCCCGTGAGGAGGCCACGGTACTGGAGTCGTTTCTGGAAGAGCACGGGGG CTGGAAATCCTTTCTGTGGACGCCGCCTTATGAGTGGCGGCAGATAAAGG TGACCTGCGCAAAATGGTCGTCGCGGGTCAGTATGCTGCGTGTTGAGTTC AGCGCAGAGTTTGAACAGGTGGTGAACTGATGCAGGATATCCGGCAGGAA ACACTGAATGAATGCACCCGTGCGGAGCAGTCGGCCAGCGTGGTGCTCTG GGAAATCGACCTGACAGAGGTCGGTGGAGAACGTTATTTTTTCTGTAATG AGCAGAACGAAAAAGGTGAGCCGGTCACCTGGCAGGGGCGACAGTATCAG CCGTATCCCATTCAGGGGAGCGGTTTTGAACTGAATGGCAAAGGCACCAG TACGCGCCCCACGCTGACGGTTTCTAACCTGTACGGTATGGTCACCGGGA TGGCGGAAGATATGCAGAGTCTGGTCGGCGGAACGGTGGTCCGGCGTAAG GTTTACGCCCGTTTTCTGGATGCGGTGAACTTCGTCAACGGAAACAGTTA CGCCGATCCGGAGCAGGAGGTGATCAGCCGCTGGCGCATTGAGCAGTGCA GCGAACTGAGCGCGGTGAGTGCCTCCTTTGTACTGTCCACGCCGACGGAA ACGGATGGCGCTGTTTTTCCGGGACGTATCATGCTGGCCAACACCTGCAC CTGGACCTATCGCGGTGACGAGTGCGGTTATAGCGGTCCGGCTGTCGCGG ATGAATATGACCAGCCAACGTCCGATATCACGAAGGATAAATGCAGCAAA TGCCTGAGCGGTTGTAAGTTCCGCAATAACGTCGGCAACTTTGGCGGCTT CCTTTCCATTAACAAACTTTCGCAGTAAATCCCATGACACAGACAGAATC AGCGATTCTGGCGCACGCCCGGCGATGTGCGCCAGCGGAGTCGTGCGGCT TCGTGGTAAGCACGCCGGAGGGGGAAAGATATTTCCCCTGCGTGAATATC TCCGGTGAGCCGGAGGCTATTTCCGTATGTCGCCGGAAGACTGGCTGCAG GCAGAAATGCAGGGTGAGATTGTGGCGCTGGTCCACAGCCACCCCGGTGG TCTGCCCTGGCTGAGTGAGGCCGACCGGCGGCTGCAGGTGCAGAGTGATT TGCCGTGGTGGCTGGTCTGCCGGGGGACGATTCATAAGTTCCGCTGTGTG CCGCATCTCACCGGGCGGCGCTTTGAGCACGGTGTGACGGACTGTTACAC ACTGTTCCGGGATGCTTATCATCTGGCGGGGATTGAGATGCCGGACTTTC ATCGTGAGGATGACTGGTGGCGTAACGGCCAGAATCTCTATCTGGATAAT CTGGAGGCGACGGGGCTGTATCAGGTGCCGTTGTCAGCGGCACAGCCGGG CGATGTGCTGCTGTGCTGTTTTGGTTCATCAGTGCCGAATCACGCCGCAA TTTACTGCGGCGACGGCGAGCTGCTGCACCATATTCCTGAACAACTGAGC AAACGAGAGAGGTACACCGACAAATGGCAGCGACGCACACACTCCCTCTG GCGTCACCGGGCATGGCGCGCATCTGCCTTTACGGGGATTTACAACGATT TGGTCGCCGCATCGACCTTCGTGTGAAAACGGGGGCTGAAGCCATCCGGG CACTGGCCACACAGCTCCCGGCGTTTCGTCAGAAACTGAGCGACGGCTGG TATCAGGTACGGATTGCCGGGCGGGACGTCAGCACGTCCGGGTTAACGGC GCAGTTACATGAGACTCTGCCTGATGGCGCTGTAATTCATATTGTTCCCA GAGTCGCCGGGGCCAAGTCAGGTGGCGTATTCCAGATTGTCCTGGGGGCT GCCGCCATTGCCGGATCATTCTTTACCGCCGGAGCCACCCTTGCAGCATG GGGGGCAGCCATTGGGGCCGGTGGTATGACCGGCATCCTGTTTTCTCTCG GTGCCAGTATGGTGCTCGGTGGTGTGGCGCAGATGCTGGCACCGAAAGCC AGAACTCCCCGTATACAGACAACGGATAACGGTAAGCAGAACACCTATTT CTCCTCACTGGATAACATGGTTGCCCAGGGCAATGTTCTGCCTGTTCTGT ACGGGGAAATGCGCGTGGGGTCACGCGTGGTTTCTCAGGAGATCAGCACG GCAGACGAAGGGGACGGTGGTCAGGTTGTGGTGATTGGTCGCTGATGCAA AATGTTTTATGTGAAACCGCCTGCGGGCGGTTTTGTCATTTATGGAGCGT GAGGAATGGGTAAAGGAAGCAGTAAGGGGCATACCCCGCGCGAAGCGAAG GACAACCTGAAGTCCACGCAGTTGCTGAGTGTGATCGATGCCATCAGCGA AGGGCCGATTGAAGGTCCGGTGGATGGCTTAAAAAGCGTGCTGCTGAACA GTACGCCGGTGCTGGACACTGAGGGGAATACCAACATATCCGGTGTCACG GTGGTGTTCCGGGCTGGTGAGCAGGAGCAGACTCCGCCGGAGGGATTTGA ATCCTCCGGCTCCGAGACGGTGCTGGGTACGGAAGTGAAATATGACACGC CGATCACCCGCACCATTACGTCTGCAAACATCGACCGTCTGCGCTTTACC TTCGGTGTACAGGCACTGGTGGAAACCACCTCAAAGGGTGACAGGAATCC GTCGGAAGTCCGCCTGCTGGTTCAGATACAACGTAACGGTGGCTGGGTGA CGGAAAAAGACATCACCATTAAGGGCAAAACCACCTCGCAGTATCTGGCC TCGGTGGTGATGGGTAACCTGCCGCCGCGCCCGTTTAATATCCGGATGCG CAGGATGACGCCGGACAGCACCACAGACCAGCTGCAGAACAAAACGCTCT GGTCGTCATACACTGAAATCATCGATGTGAAACAGTGCTACCCGAACACG GCACTGGTCGGCGTGCAGGTGGACTCGGAGCAGTTCGGCAGCCAGCAGGT GAGCCGTAATTATCATCTGCGCGGGCGTATTCTGCAGGTGCCGTCGAACT ATAACCCGCAGACGCGGCAATACAGCGGTATCTGGGACGGAACGTTTAAA CCGGCATACAGCAACAACATGGCCTGGTGTCTGTGGGATATGCTGACCCA TCCGCGCTACGGCATGGGGAAACGTCTTGGTGCGGCGGATGTGGATAAAT GGGCGCTGTATGTCATCGGCCAGTACTGCGACCAGTCAGTGCCGGACGGC TTTGGCGGCACGGAGCCGCGCATCACCTGTAATGCGTACCTGACCACACA GCGTAAGGCGTGGGATGTGCTCAGCGATTTCTGCTCGGCGATGCGCTGTA TGCCGGTATGGAACGGGCAGACGCTGACGTTCGTGCAGGACCGACCGTCG GATAAGACGTGGACCTATAACCGCAGTAATGTGGTGATGCCGGATGATGG CGCGCCGTTCCGCTACAGCTTCAGCGCCCTGAAGGACCGCCATAATGCCG TTGAGGTGAACTGGATTGACCCGAACAACGGCTGGGAGACGGCGACAGAG CTTGTTGAAGATACGCAGGCCATTGCCCGTTACGGTCGTAATGTTACGAA GATGGATGCCTTTGGCTGTACCAGCCGGGGGCAGGCACACCGCGCCGGGC TGTGGCTGATTAAAACAGAACTGCTGGAAACGCAGACCGTGGATTTCAGC GTCGGCGCAGAAGGGCTTCGCCATGTACCGGGCGATGTTATTGAAATCTG CGATGATGACTATGCCGGTATCAGCACCGGTGGTCGTGTGCTGGCGGTGA ACAGCCAGACCCGGACGCTGACGCTCGACCGTGAAATCACGCTGCCATCC TCCGGTACCGCGCTGATAAGCCTGGTTGACGGAAGTGGCAATCCGGTCAG CGTGGAGGTTCAGTCCGTCACCGACGGCGTGAAGGTAAAAGTGAGCCGTG TTCCTGACGGTGTTGCTGAATACAGCGTATGGGAGCTGAAGCTGCCGACG CTGCGCCAGCGACTGTTCCGCTGCGTGAGTATCCGTGAGAACGACGACGG CACGTATGCCATCACCGCCGTGCAGCATGTGCCGGAAAAAGAGGCCATCG TGGATAACGGGGCGCACTTTGACGGCGAACAGAGTGGCACGGTGAATGGT GTCACGCCGCCAGCGGTGCAGCACCTGACCGCAGAAGTCACTGCAGACAG CGGGGAATATCAGGTGCTGGCGCGATGGGACACACCGAAGGTGGTGAAGG GCGTGAGTTTCCTGCTCCGTCTGACCGTAACAGCGGACGACGGCAGTGAG CGGCTGGTCAGCACGGCCCGGACGACGGAAACCACATACCGCTTCACGCA ACTGGCGCTGGGGAACTACAGGCTGACAGTCCGGGCGGTAAATGCGTGGG GGCAGCAGGGCGATCCGGCGTCGGTATCGTTCCGGATTGCCGCACCGGCA GCACCGTCGAGGATTGAGCTGACGCCGGGCTATTTTCAGATAACCGCCAC GCCGCATCTTGCCGTTTATGACCCGACGGTACAGTTTGAGTTCTGGTTCT CGGAAAAGCAGATTGCGGATATCAGACAGGTTGAAACCAGCACGCGTTAT CTTGGTACGGCGCTGTACTGGATAGCCGCCAGTATCAATATCAAACCGGG CCATGATTATTACTTTTATATCCGCAGTGTGAACACCGTTGGCAAATCGG CATTCGTGGAGGCCGTCGGTCGGGCGAGCGATGATGCGGAAGGTTACCTG GATTTTTTCAAAGGCAAGATAACCGAATCCCATCTCGGCAAGGAGCTGCT GGAAAAAGTCGAGCTGACGGAGGATAACGCCAGCAGACTGGAGGAGTTTT CGAAAGAGTGGAAGGATGCCAGTGATAAGTGGAATGCCATGTGGGCTGTC AAAATTGAGCAGACCAAAGACGGCAAACATTATGTCGCGGGTATTGGCCT CAGCATGGAGGACACGGAGGAAGGCAAACTGAGCCAGTTTCTGGTTGCCG CCAATCGTATCGCATTTATTGACCCGGCAAACGGGAATGAAACGCCGATG TTTGTGGCGCAGGGCAACCAGATATTCATGAACGACGTGTTCCTGAAGCG CCTGACGGCCCCCACCATTACCAGCGGCGGCAATCCTCCGGCCTTTTCCC TGACACCGGACGGAAAGCTGACCGCTAAAAATGCGGATATCAGTGGCAGT GTGAATGCGAACTCCGGGACGCTCAGTAATGTGACGATAGCTGAAAACTG TACGATAAACGGTACGCTGAGGGCGGAAAAAATCGTCGGGGACATTGTAA AGGCGGCGAGCGCGGCTTTTCCGCGCCAGCGTGAAAGCAGTGTGGACTGG CCGTCAGGTACCCGTACTGTCACCGTGACCGATGACCATCCTTTTGATCG CCAGATAGTGGTGCTTCCGCTGACGTTTCGCGGAAGTAAGCGTACTGTCA GCGGCAGGACAACGTATTCGATGTGTTATCTGAAAGTACTGATGAACGGT GCGGTGATTTATGATGGCGCGGCGAACGAGGCGGTACAGGTGTTCTCCCG TATTGTTGACATGCCAGCGGGTCGGGGAAACGTGATCCTGACGTTCACGC TTACGTCCACACGGCATTCGGCAGATATTCCGCCGTATACGTTTGCCAGC GATGTGCAGGTTATGGTGATTAAGAAACAGGCGCTGGGCATCAGCGTGGT CTGAGTGTGTTACAGAGGTTCGTCCGGGAACGGGCGTTTTATTATAAAAC AGTGAGAGGTGAACGATGCGTAATGTGTGTATTGCCGTTGCTGTCTTTGC CGCACTTGCGGTGACAGTCACTCCGGCCCGTGCGGAAGGTGGACATGGTA CGTTTACGGTGGGCTATTTTCAAGTGAAACCGGGTACATTGCCGTCGTTG TCGGGCGGGGATACCGGTGTGAGTCATCTGAAAGGGATTAACGTGAAGTA CCGTTATGAGCTGACGGACAGTGTGGGGGTGATGGCTTCCCTGGGGTTCG CCGCGTCGAAAAAGAGCAGCACAGTGATGACCGGGGAGGATACGTTTCAC TATGAGAGCCTGCGTGGACGTTATGTGAGCGTGATGGCCGGACCGGTTTT ACAAATCAGTAAGCAGGTCAGTGCGTACGCCATGGCCGGAGTGGCTCACA GTCGGTGGTCCGGCAGTACAATGGATTACCGTAAGACGGAAATCACTCCC GGGTATATGAAAGAGACGACCACTGCCAGGGACGAAAGTGCAATGCGGCA TACCTCAGTGGCGTGGAGTGCAGGTATACAGATTAATCCGGCAGCGTCCG TCGTTGTTGATATTGCTTATGAAGGCTCCGGCAGTGGCGACTGGCGTACT GACGGATTCATCGTTGGGGTCGGTTATAAATTCTGATTAGCCAGGTAACA CAGTGTTATGACAGCCCGCCGGAACCGGTGGGCTTTTTTGTGGGGTGAAT ATGGCAGTAAAGATTTCAGGAGTCCTGAAAGACGGCACAGGAAAACCGGT ACAGAACTGCACCATTCAGCTGAAAGCCAGACGTAACAGCACCACGGTGG TGGTGAACACGGTGGGCTCAGAGAATCCGGATGAAGCCGGGCGTTACAGC ATGGATGTGGAGTACGGTCAGTACAGTGTCATCCTGCAGGTTGACGGTTT TCCACCATCGCACGCCGGGACCATCACCGTGTATGAAGATTCACAACCGG GGACGCTGAATGATTTTCTCTGTGCCATGACGGAGGATGATGCCCGGCCG GAGGTGCTGCGTCGTCTTGAACTGATGGTGGAAGAGGTGGCGCGTAACGC GTCCGTGGTGGCACAGAGTACGGCAGACGCGAAGAAATCAGCCGGCGATG CCAGTGCATCAGCTGCTCAGGTCGCGGCCCTTGTGACTGATGCAACTGAC TCAGCACGCGCCGCCAGCACGTCCGCCGGACAGGCTGCATCGTCAGCTCA GGAAGCGTCCTCCGGCGCAGAAGCGGCATCAGCAAAGGCCACTGAAGCGG AAAAAAGTGCCGCAGCCGCAGAGTCCTCAAAAAACGCGGCGGCCACCAGT GCCGGTGCGGCGAAAACGTCAGAAACGAATGCTGCAGCGTCACAACAATC AGCCGCCACGTCTGCCTCCACCGCGGCCACGAAAGCGTCAGAGGCCGCCA CTTCAGCACGAGATGCGGTGGCCTCAAAAGAGGCAGCAAAATCATCAGAA ACGAACGCATCATCAAGTGCCGGTCGTGCAGCTTCCTCGGCAACGGCGGC AGAAAATTCTGCCAGGGCGGCAAAAACGTCCGAGACGAATGCCAGGTCAT CTGAAACAGCAGCGGAACGGAGCGCCTCTGCCGCGGCAGACGCAAAAACA GCGGCGGCGGGGAGTGCGTCAACGGCATCCACGAAGGCGACAGAGGCTGC GGGAAGTGCGGTATCAGCATCGCAGAGCAAAAGTGCGGCAGAAGCGGCGG CAATACGTGCAAAAAATTCGGCAAAACGTGCAGAAGATATAGCTTCAGCT GTCGCGCTTGAGGATGCGGACACAACGAGAAAGGGGATAGTGCAGCTCAG CAGTGCAACCAACAGCACGTCTGAAACGCTTGCTGCAACGCCAAAGGCGG TTAAGGTGGTAATGGATGAAACGAACAGAAAAGCCCACTGGACAGTCCGG CACTGACCGGAACGCCAACAGCACCAACCGCGCTCAGGGGAACAAACAAT ACCCAGATTGCGAACACCGCTTTTGTACTGGCCGCGATTGCAGATGTTAT CGACGCGTCACCTGACGCACTGAATACGCTGAATGAACTGGCCGCAGCGC TCGGGAATGATCCAGATTTTGCTACCACCATGACTAACGCGCTTGCGGGT AAACAACCGAAGAATGCGACACTGACGGCGCTGGCAGGGCTTTCCACGGC GAAAAATAAATTACCGTATTTTGCGGAAAATGATGCCGCCAGCCTGACTG AACTGACTCAGGTTGGCAGGGATATTCTGGCAAAAAATTCCGTTGCAGAT GTTCTTGAATACCTTGGGGCCGGTGAGAATTCGGCCTTTCCGGCAGGTGC GCCGATCCCGTGGCCATCAGATATCGTTCCGTCTGGCTACGTCCTGATGC AGGGGCAGGCGTTTGACAAATCAGCCTACCCAAAACTTGCTGTCGCGTAT CCATCGGGTGTGCTTCCTGATATGCGAGGCTGGACAATCAAGGGGAAACC CGCCAGCGGTCGTGCTGTATTGTCTCAGGAACAGGATGGAATTAAGTCGC ACACCCACAGTGCCAGTGCATCCGGTACGGATTTGGGGACGAAAACCACA TCGTCGTTTGATTACGGGACGAAAACAACAGGCAGTTTCGATTACGGCAC CAAATCGACGAATAACACGGGGGCTCATGCTCACAGTCTGAGCGGTTCAA CAGGGGCCGCGGGTGCTCATGCCCACACAAGTGGTTTAAGGATGAACAGT TCTGGCTGGAGTCAGTATGGAACAGCAACCATTACAGGAAGTTTATCCAC AGTTAAAGGAACCAGCACACAGGGTATTGCTTATTTATCGAAAACGGACA GTCAGGGCAGCCACAGTCACTCATTGTCCGGTACAGCCGTGAGTGCCGGT GCACATGCGCATACAGTTGGTATTGGTGCGCACCAGCATCCGGTTGTTAT CGGTGCTCATGCCCATTCTTTCAGTATTGGTTCACACGGACACACCATCA CCGTTAACGCTGCGGGTAACGCGGAAAACACCGTCAAAAACATTGCATTT AACTATATTGTGAGGCTTGCATAATGGCATTCAGAATGAGTGAACAACCA CGGACCATAAAAATTTATAATCTGCTGGCCGGAACTAATGAATTTATTGG TGAAGGTGACGCATATATTCCGCCTCATACCGGTCTGCCTGCAAACAGTA CCGATATTGCACCGCCAGATATTCCGGCTGGCTTTGTGGCTGTTTTCAAC AGTGATGAGGCATCGTGGCATCTCGTTGAAGACCATCGGGGTAAAACCGT CTATGACGTGGCTTCCGGCGACGCGTTATTTATTTCTGGAACTCGGTCCG TTACCGGAAAAtTTTACCTGGTTATCGCCGGGAGGGGAATATCAGAAGTG GAACGGCACAGCCTGGGTGAAGGATACGGAAGCAGAAAAACTGTTCCGGA TCCGGGAGGCGGAAGAAACAAAAAAAAGCCTGATGCAGGTAGCCAGTGAG CATATTGCGCCGCTTCAGGATGCTGCAGATCTGGAAATTGCAACGAAGGA AGAAACCTCGTTGCTGGAAGCCTGGAAGAAGTATCGGGTGTTGCTGAACC GTGTTGATACATCAACTGCACCTGATATTGAGTGGCCTGCTGTCCCTGTT ATGGAGTAATCGTTTTGTGATATGCCGCAGAAACGTTGTATGAAATAACG TTCTGCGGTTAGTTAGTATATTGTAAAGCTGAGTATTGGTTTATTTGGCG ATTATTATCTTCAGGAGAATAATGGAAGTTCTATGACTCAATTGTTCATA GTGTTTACATCACCGCCAATTGCTTTTAAGACTGAACGCATGAAATATGG TTTTTCGTCATGTTTTGAGTCTGCTGTTGATATTTCTAAAGTCGGTTTTT TTTCTTCGTTTTCTCTAACTATTTTCCATGAAATACATTTTTGATTATTA TTTGAATCAATTCCAATTACCTGAAGTCTTTCATCTATAATTGGCATTGT ATGTATTGGTTTATTGGAGTAGATGCTTGCTTTTCTGAGCCATAGCTCTG ATATCCAAATGAAGCCATAGGCATTTGTTATTTTGGCTCTGTCAGCTGCA TAACGCCAAAAAATATATTTATCTGCTTGATCTTCAAATGTTGTATTGAT TAAATCAATTGGATGGAATTGTTTATCATAAAAAATTAATGTTTGAATGT GATAACCGTCCTTTAAAAAAGTCGTTTCTGCAAGCTTGGCTGTATAGTCA ACTAACTCTTCTGTCGAAGTGATATTTTTAGGCTTATCTACCAGTTTTAG ACGCTCTTTAATATCTTCAGGAATTATTTTATTGTCATATTGTATCATGC TAAATGACAATTTGCTTATGGAGTAATCTTTTAATTTTAAATAAGTTATT CTCCTGGCTTCATCAAATAAAGAGTCGAATGATGTTGGCGAAATCACATC GTCACCCATTGGATTGTTTATTTGTATGCCAAGAGAGTTACAGCAGTTAT ACATTCTGCCATAGATTATAGCTAAGGCATGTAATAATTCGTAATCTTTT AGCGTATTAGCGACCCATCGTCTTTCTGATTTAATAATAGATGATTCAGT TAAATATGAAGGTAATTTCTTTTGTGCAAGTCTGACTAACTTTTTTATAC CAATGTTTAACATACTTTCATTTGTAATAAACTCAATGTCATTTTCTTCA ATGTAAGATGAAATAAGAGTAGCCTTTGCCTCGCTATACATTTCTAAATC GCCTTGTTTTTCTATCGTATTGCGAGAATTTTTAGCCCAAGCCATTAATG GATCATTTTTCCATTTTTCAATAACATTATTGTTATACCAAATGTCATAT CCTATAATCTGGTTTTTGTTTTTTTGAATAATAAATGTTACTGTTCTTGC GGTTTGGAGGAATTGATTCAAATTCAAGCGAAATAATTCAGGGTCAAAAT ATGTATCAATGCAGCATTTGAGCAAGTGCGATAAATCTTTAAGTCTTCTT TCCCATGGTTTTTTAGTCATAAAACTCTCCATTTTGATAGGTTGCATGCT AGATGCTGATATATTTTAGAGGTGATAAAATTAACTGCTTAACTGTCAATGTAATACAAGTTGTTTGATCTTTGCAATGATTCTTATCAGAAACCATATA GTAAATTAGTTACACAGGAAATTTTTAATATTATTATTATCATTCATTAT GTATTAAAATTAGAGTTGTGGCTTGGCTCTGCTAACACGTTGCTCATAGG AGATATGGTAGAGCCGCAGACACGTCGTATGCAGGAACGTGCTGCGGCTG GCTGGTGAACTTCCGATAGTGCGGGTGTTGAATGATTTCCAGTTGCTACC GATTTTACATATTTTTTGCATGAGAGAATTTGTACCACCTCCCACCGACC ATCTATGACTGTACGCCACTGTCCCTAGGACTGCTATGTGCCGGAGCGGA CATTACAAACGTCCTTCTCGGTGCATGCCACTGTTGCCAATGACCTGCCT AGGAATTGGTTAGCAAGTTACTACCGGATTTTGTAAAAACAGCCCTCCTC ATATAAAAAGTATTCGTTCACTTCCGATAAGCGTCGTAATTTTCTATCTT TCATCATATTCTAGATCCCTCTGAAAAAATCTTCCGAGTTTGCTAGGCAC TGATACATAACTCTTTTCCAATAATTGGGGAAGTCATTCAAATCTATAAT AGGTTTCAGATTTGCTTCAATAAATTCTGACTGTAGCTGCTGAAACGTTG CGGTTGAACTATATTTCCTTATAACTTTTACGAAAGAGTTTCTTTGAGTA ATCACTTCACTCAAGTGCTTCCCTGCCTCCAAACGATACCTGTTAGCAAT ATTTAATAGCTTGAAATGATGAAGAGCTCTGTGTTTGTCTTCCTGCCTCC AGTTCGCCGGGCATTCAACATAAAAACTGATAGCACCCGGAGTTCCGGAA ACGAAATTTGCATATACCCATTGCTCACGAAAAAAAATGTCCTTGTCGAT ATAGGGATGAATCGCTTGGTGTACCTCATCTACTGCGAAAACTTGACCTT TCTCTCCCATATTGCAGTCGCGGCACGATGGAACTAAATTAATAGGCATC ACCGAAAATTCAGGATAATGTGCAATAGGAAGAAAATGATCTATATTTTT TGTCTGTCCTATATCACCACAAAATGGACATTTTTCACCTGATGAAACAA GCATGTCATCGTAATATGTTCTAGCGGGTTTGTTTTTATCTCGGAGATTA TTTTCATAAAGCTTTTCTAATTTAACCTTTGTCAGGTTACCAACTACTAA GGTTGTAGGCTCAAGAGGGTGTGTCCTGTCGTAGGTAAATAACTGACCTG TCGAGCTTAATATTCTATATTGTTGTTCTTTCTGCAAAAAAGTGGGGAAG TGAGTAATGAAATTATTTCTAACATTTATCTGCATCATACCTTCCGAGCA TTTATTAAGCATTTCGCTATAAGTTCTCGCTGGAAGAGGTAGTTTTTTCA TTGTACTTTACCTTCATCTCTGTTCATTATCATCGCTTTTAAAACGGTTC GACCTTCTAATCCTATCTGACCATTATAATTTTTTAGAATGGTTTCATAA GAAAGCTCTGAATCAACGGACTGCGATAATAAGTGGTGGTATCCAGAATT TGTCACTTCAAGTAAAAACACCTCACGAGTTAAAACACCTAAGTTCTCAC CGAATGTCTCAATATCCGGACGGATAATATTTATTGCTTCTCTTGACCGT AGGACTTTCCACATGCAGGATTTTGGAACCTCTTGCAGTACTACTGGGGA ATGAGTTGCAATTATTGCTACACCATTGCGTGCATCGAGTAAGTCGCTTA ATGTTCGTAAAAAAGCAGAGAGCAAAGGTGGATGCAGATGAACCTCTGGT TCATCGAATAAAACTAATGACTTTTCGCCAACGACATCTACTAATCTTGT GATAGTAAATAAAACAATTGCATGTCCAGAGCTCATTCGAAGCAGATATT TCTGGATATTGTCATAAAACAATTTAGTGAATTTATCATCGTCCACTTGA ATCTGTGGTTCATTACGTCTTAACTCTTCATATTTAGAAATGAGGCTGAT GAGTTCCATATTTGAAAAGTTTTCATCACTACTTAGTTTTTTGATAGCTT CAAGCCAGAGTTGTCTTTTTCTATCTACTCTCATACAACCAATAAATGCT GAAATGAATTCTAAGCGGAGATCGCCTAGTGATTTTAAACTATTGCTGGC AGCATTCTTGAGTCCAATATAAAAGTATTGTGTACCTTTTGCTGGGTCAG GTTGTTCTTTAGGAGGAGTAAAAGGATCAAATGCACTAAACGAAACTGAA ACAAGCGATCGAAAATATCCCTTTGGGATTCTTGACTCGATAAGTCTATT ATTTTCAGAGAAAAAATATTCATTGTTTTCTGGGTTGGTGATTGCACCAA TCATTCCATTCAAAATTGTTGTTTTACCACACCCATTCCGCCCGATAAAA GCATGAATGTTCGTGCTGGGCATAGAATTAACCGTCACCTCAAAAGGTAT AGTTAAATCACTGAATCCGGGAGCACTTTTTCTATTAAATGAAAAGTGGA AATCTGACAATTCTGGCAAACCATTTAACACACGTGCGAACTGTCCATGA ATTTCTGAAAGAGTTACCCCTCTAAGTAATGAGGTGTTAAGGACGCTTTC ATTTTCAATGTCGGCTAATCGATTTGGCCATACTACTAAATCCTGAATAG CTTTAAGAAGGTTATGTTTAAAACCATCGCTTAATTTGCTGAGATTAACA TAGTAGTCAATGCTTTCACCTAAGGAAAAAAACATTTCAGGGAGTTGACT GAATTTTTTATCTATTAATGAATAAGTGCTTACTTCTTCTTTTTGACCTA CAAAACCAATTTTAACATTTCCGATATCGCATTTTTCACCATGCTCATCA AAGACAGTAAGATAAAACATTGTAACAAAGGAATAGTCATTCCAACCATC TGCTCGTAGGAATGCCTTATTTTTTTCTACTGCAGGAATATACCCGCCTC TTTCAATAACACTAAACTCCAACATATAGTAACCCTTAATTTTATTAAAA TAACCGCAATTTATTTGGCGGCAACACAGGATCTCTCTTTTAAGTTACTC TCTATTACATACGTTTTCCATCTAAAAATTAGTAGTATTGAACTTAACGG GGCATCGTATTGTAGTTTTCCATATTTAGCTTTCTGCTTCCTTTTGGATA ACCCACTGTTATTCATGTTGCATGGTGCACTGTTTATACCAACGATATAG TCTATTAATGCATATATAGTATCGCCGAACGATTAGCTCTTCAGGCTTCT GAAGAAGCGTTTCAAGTACTAATAAGCCGATAGATAGCCACGGACTTCGT AGCCATTTTTCATAAGTGTTAACTTCCGCTCCTCGCTCATAACAGACATT CACTACAGTTATGGCGGAAAGGTATGCATGCTGGGTGTGGGGAAGTCGTG AAAGAAAAGAAGTCAGCTGCGTCGTTTGACATCACTGCTATCTTCTTACT GGTTATGCAGGTCGTAGTGGGTGGCACACAAAGCTTTGCACTGGATTGCG AGGCTTTGTGCTTCTCTGGAGTGCGACAGGTTTGATGACAAAAAATTAGC GCAAGAAGACAAAAATCACCTTGCGCTAATGCTCTGTTACAGGTCACTAA TACCATCTAAGTAGTTGATTCATAGTGACTGCATATGTTGTGTTTTACAG TATTATGTAGTCTGTTTTTTATGCAAAATCTAATTTAATATATTGATATT TATATCATTTTACGTTTCTCGTTCAGCTTTTTTATACTAAGTTGGCATTA TAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGT CAAAATAAAATCATTATTTGATTTCAATTTTGTCCCACTCCCTGCCTCTG TCATCACGATACTGTGATGCCATGGTGTCCGACTTATGCCCGAGAAGATG TTGAGCAAACTTATCGCTTATCTGCTTCTCATAGAGTCTTGCAGACAAAC TGCGCAACTCGTGAAAGGTAGGCGGATCCCCTTCGAAGGAAAGACCTGAT GCTTTTCGTGCGCGCATAAAATACCTTGATACTGTGCCGGATGAAAGCGG TTCGCGACGAGTAGATGCAATTATGGTTTCTCCGCCAAGAATCTCTTTGC ATTTATCAAGTGTTTCCTTCATTGATATTCCGAGAGCATCAATATGCAAT GCTGTTGGGATGGCAATTTTTACGCCTGTTTTGCTTTGCTCGACATAAAG ATATCCATCTACGATATCAGACCACTTCATTTCGCATAAATCACCAACTC GTTGCCCGGTAACAACAGCCAGTTCCATTGCAAGTCTGAGCCAACATGGT GATGATTCTGCTGCTTGATAAATTTTCAGGTATTCGTCAGCCGTAAGTCT TGATCTCCTTACCTCTGATTTTGCTGCGCGAGTGGCAGCGACATGGTTTG TTGTTATATGGCCTTCAGCTATTGCCTCTCGGAATGCATCGCTCAGTGTT GATCTGATTAACTTGGCTGACGCCGCCTTGCCCTCGTCTATGTATCCATT GAGCATTGCCGCAATTTCTTTTGTGGTGATGTCTTCAAGTGGAGCATCAG GCAGACCCCTCCTTATTGCTTTAATTTTGCTCATGTAATTTATGAGTGTC TTCTGCTTGATTCCTCTGCTGGCCAGGATTTTTTCGTAGCGATCAAGCCA TGAATGTAACGTAACGGAATTATCACTGTTGATTCTCGCTGTCAGAGGCT TGTGTTTGTGTCCTGAAAATAACTCAATGTTGGCCTGTATAGCTTCAGTG ATTGCGATTCGCCTGTCTCTGCCTAATCCAAACTCTTTACCCGTCCTTGG GTCCCTGTAGCAGTAATATCCATTGTTTCTTATATAAAGGTTAGGGGGTA AATCCCGGCGCTCATGACTTCGCCTTCTTCCCATTTCTGATCCTCTTCAA AAGGCCACCTGTTACTGGTCGATTTAAGTCAACCTTTACCGCTGATTCGT GGAACAGATACTCTCTTCCATCCTTAACCGGAGGTGGGAATATCCTGCAT TCCCGAACCCATCGACGAACTGTTTCAAGGCTTCTTGGACGTCGCTGGCG TGCGTTCCACTCCTGAAGTGTCAAGTACATCGCAAAGTCTCCGCAATTAC ACGCAAGAAAAAACCGCCATCAGGCGGCTTGGTGTTCTTTCAGTTCTTCA ATTCGAATATTGGTTACGTCTGCATGTGCTATCTGCGCCCATATCATCCA GTGGTCGTAGCAGTCGTTGATGTTCTCCGCTTCGATAACTCTGTTGAATG GCTCTCCATTCCATTCTCCTGTGACTCGGAAGTGCATTTATCATCTCCAT AAAACAAAACCCGCCGTAGCGAGTTCAGATAAAATAAATCCCCGCGAGTG CGAGGATTGTTATGTAATATTGGGTTTAATCATCTATATGTTTTGTACAG AGAGGGCAAGTATCGTTTCCACCGTACTCGTGATAATAATTTTGCACGGT ATCAGTCATTTCTCGCACATTGCAGAATGGGGATTTGTCTTCATTAGACT TATAAACCTTCATGGAATATTTGTATGCCGACTCTATATCTATACCTTCA TCTACATAAACACCTTCGTGATGTCTGCATGGAGACAAGACACCGGATCT GCACAACATTGATAACGCCCAATCTTTTTGCTCAGACTCTAACTCATTGA TACTCATTTATAAACTCCTTGCAATGTATGTCGTTTCAGCTAAACGGTAT CAGCAATGTTTATGTAAAGAAACAGTAAGATAATACTCAACCCGATGTTT GAGTACGGTCATCATCTGACACTACAGACTCTGGCATCGCTGTGAAGACG ACGCGAAATTCAGCATTTTCACAAGCGTTATCTTTTACAAAACCGATCTC ACTCTCCTTTGATGCGAATGCCAGCGTCAGACATCATATGCAGATACTCA CCTGCATCCTGAACCCATTGACCTCCAACCCCGTAATAGCGATGCGTAAT GATGTCGATAGTTACTAACGGGTCTTGTTCGATTAACTGCCGCAGAAACT CTTCCAGGTCACCAGTGCAGTGCTTGATAACAGGAGTCTTCCCAGGATGG CGAACAACAAGAAACTGGTTTCCGTCTTCACGGACTTCGTTGCTTTCCAG TTTAGCAATACGCTTACTCCCATCCGAGATAACACCTTCGTAATACTCAC GCTGCTCGTTGAGTTTTGATTTTGCTGTTTCAAGCTCAACACGCAGTTTC CCTACTGTTAGCGCAATATCCTCGTTCTCCTGGTCGCGGCGTTTGATGTA TTGCTGGTTTCTTTCCCGTTCATCCAGCAGTTCCAGCACAATCGATGGTG TTACCAATTCATGGAAAAGGTCTGCGTCAAATCCCCAGTCGTCATGCATT GCCTGCTCTGCCGCTTCACGCAGTGCCTGAGAGTTAATTTCGCTCACTTC GAACCTCTCTGTTTACTGATAAGTTCCAGATCCTCCTGGCAACTTGCACA AGTCCGACAACCCTGAACGACCAGGCGTCTTCGTTCATCTATCGGATCGC CACACTCACAACAATGAGTGGCAGATATAGCCTGGTGGTTCAGGCGGCGC ATTTTTATTGCTGTGTTGCGCTGTAATTCTTCTATTTCTGATGCTGAATC AATGATGTCTGCCATCTTTCATTAATCCCTGAACTGTTGGTTAATACGCT TGAGGGTGAATGCGAATAATAAAAAAGGAGCCTGTAGCTCCCTGATGATT TTGCTTTTCATGTTCATCGTTCCTTAAAGACGCCGTTTAACATGCCGATT GCCAGGCTTAAATGAGTCGGTGTGAATCCCATCAGCGTTACCGTTTCGCG GTGCTTCTTCAGTACGCTACGGCAAATGTCATCGACGTTTTTATCCGGAA ACTGCTGTCTGGCTTTTTTTGATTTCAGAATTAGCCTGACGGGCAATGCT GCGAAGGGCGTTTTCCTGCTGAGGTGTCATTGAACAAGTCCCATGTCGGC AAGCATAAGCACACAGAATATGAAGCCCGCTGCCAGAAAAATGCATTCCG TGGTTGTCATACCTGGTTTCTCTCATCTGCTTCTGCTTTCGCCACCATCA TTTCCAGCTTTTGTGAAAGGGATGCGGCTAACGTATGAAATTCTTCGTCT GTTTCTACTGGTATTGGCACAAACCTGATTCCAATTTGAGCAAGGCTATG TGCCATCTCGATACTCGTTCTTAACTCAACAGAAGATGCTTTGTGCATAC AGCCCCTCGTTTATTATTTATCTCCTCAGCCAGCCGCTGTGCTTTCAGTG GATTTCGGATAACAGAAAGGCCGGGAAATACCCAGCCTCGCTTTGTAACG GAGTAGACGAAAGTGATTGCGCCTACCCGGATATTATCGTGAGGATGCGT CATCGCCATTGCTCCCCAAATACAAAACCAATTTCAGCCAGTGCCTCGTC CATTTTTTCGATGAACTCCGGCACGATCTCGTCAAAACTCGCCATGTACT TTTCATCCCGCTCAATCACGACATAATGCAGGCCTTCACGCTTCATACGC GGGTCATAGTTGGCAAAGTACCAGGCATTTTTTCGCGTCACCCACATGCT GTACTGCACCTGGGCCATGTAAGCTGACTTTATGGCCTCGAAACCACCGA GCCGGAACTTCATGAAATCCCGGGAGGTAAACGGGCATTTCAGTTCAAGG CCGTTGCCGTCACTGCATAAACCATCGGGAGAGCAGGCGGTACGCATACT TTCGTCGCGATAGATGATCGGGGATTCAGTAACATTCACGCCGGAAGTGA ATTCAAACAGGGTTCTGGCGTCGTTCTCGTACTGTTTTCCCCAGGCCAGT GCTTTAGCGTTAACTTCCGGAGCCACACCGGTGCAAACCTCAGCAAGCAG GGTGTGGAAGTAGGACATTTTCATGTCAGGCCACTTCTTTCCGGAGCGGG GTTTTGCTATCACGTTGTGAACTTCTGAAGCGGTGATGACGCCGAGCCGT AATTTGTGCCACGCATCATCCCCCTGTTCGACAGCTCTCACATCGATCCC GGTACGCTGCAGGATAATGTCCGGTGTCATGCTGCCACCTTCTGCTCTGC GGCTTTCTGTTTCAGGAATCCAAGAGCTTTTACTGCTTCGGCCTGTGTCA GTTCTGACGATGCACGAATGTCGCGGCGAAATATCTGGGAACAGAGCGGC AATAAGTCGTCATCCCATGTTTTATCCAGGGCGATCAGCAGAGTGTTAAT CTCCTGCATGGTTTCATCGTTAACCGGAGTGATGTCGCGTTCCGGCTGAC GTTCTGCAGTGTATGCAGTATTTTCGACAATGCGCTCGGCTTCATCCTTG TCATAGATACCAGCAAATCCGAAGGCCAGACGGGCACACTGAATCATGGC TTTATGACGTAACATCCGTTTGGGATGCGACTGCCACGGCCCCGTGATTT CTCTGCCTTCGCGAGTTTTGAATGGTTCGCGGCGGCATTCATCCATCCAT TCGGTAACGCAGATCGGATGATTACGGTCCTTGCGGTAAATCCGGCATGT CATGTACAGGATTCATTGTCCTGCTCAAAGTCCATGCCATCAAACTGCTG GTTTTCATTGATGATGCGGGACCAGCCATCAACGCCCACCACCGGAACGA TGCCATTCTGCTTATCAGGAAAGGCGTAAATTTCTTTCGTCCACGGATTA AGGCCGTACTGGTTGGCAACGATCAGTAATGCGATGAACTGCGCATCGCT GGCATCACCTTTAAATGCCGTCTGGCGAAGAGTGGTGATCAGTTCCTGTG GGTCGACAGAATCCATGCCGACACGTTCAGCCAGCTTCCCAGCCAGCGTT GCGAGTGCAGTACTCATTCGTTTTATACCTCTGAATCAATATCAACCTGG TGGTGAGCAATGGTTTCAACCATGTACCGGATGTGTTCTGCCATGCGCTC CTGAAACTCAACATCGTCATCAAACGCACGGGTAATGGATTTTTTGCTGG CCCCGTGGCGTTGCAAATGATCGATGCATAGCGATTCAAACAGGTGCTGG GGCAGGCCTTTTTCCATGTCGTCTGCCAGTTCTGCCTCTTTCTCTTCACG GGCGAGCTGCTGGTAGTGACGCGCCCAGCTCTGAGCCTCAAGACGATCCT GAATGTAATAAGCGTTCATGGCTGAACTCCTGAAATAGCTGTGAAAATAT CGCCCGCGAAATGCCGGGCTGATTAGGAAAACAGGAAAGGGGGTTAGTGA ATGCTTTTGCTTGATCTCAGTTTCAGTATTAATATCCATTTTTTATAAGC GTCGACGGCTTCACGAAACATCTTTTCATCGCCAATAAAAGTGGCGATAG TGAATTTAGTCTGGATAGCCATAAGTGTTTGATCCATTCTTTGGGACTCC TGGCTGATTAAGTATGTCGATAAGGCGTTTCCATCCGTCACGTAATTTAC GGGTGATTCGTTCAAGTAAAGATTCGGAAGGGCAGCCAGCAACAGGCCAC CCTGCAATGGCATATTGCATGGTGTGCTCCTTATTTATACATAACGAAAA ACGCCTCGAGTGAAGCGTTATTGGTATGCGGTAAAACCGCACTCAGGCGG CCTTGATAGTCATATCATCTGAATCAAATATTCCTGATGTATCGATATCG GTAATTCTTATTCCTTCGCTACCATCCATTGGAGGCCATCCTTCCTGACC ATTTCCATCATTCCAGTCGAACTCACACACAACACCATATGCATTTAAGT CGCTTGAAATTGCTATAAGCAGAGCATGTTGCGCCAGCATGATTAATACA GCATTTAATACAGAGCCGTGTTTATTGAGTCGGTATTCAGAGTCTGACCA GAAATTATTAATCTGGTGAAGTTTTTCCTCTGTCATTACGTCATGGTCGA TTTCAATTTCTATTGATGCTTTCCAGTCGTAATCAATGATGTATTTTTTG ATGTTTGACATCTGTTCATATCCTCACAGATAAAAAATCGCCCTCACACT GGAGGGCAAAGAAGATTTCCAATAATCAGAACAAGTCGGCTCCTGTTTAG TTACGAGCGACATTGCTCCGTGTATTCACTCGTTGGAATGAATACACAGT GCAGTGTTTATTCTGTTATTTATGCCAAAAATAAAGGCCACTATCAGGCA GCTTTGTTGTTCTGTTTACCAAGTTCTCTGGCAATCATTGCCGTCGTTCG TATTGCCCATTTATCGACATATTTCCCATCTTCCATTACAGGAAACATTT CTTCAGGCTTAACCATGCATTCCGATTGCAGCTTGCATCCATTGCATCGC TTGAATTGTCCACACCATTGATTTTTATCAATAGTCGTAGTCATACGGAT AGTCCTGGTATTGTTCCATCACATCCTGAGGATGCTCTTCGAACTCTTCA AATTCTTCTTCCATATATCACCTTAAATAGTGGATTGCGGTAGTAAAGAT TGTGCCTGTCTTTTAACCACATCAGGCTCGGTGGTTCTCGTGTACCCCTA CAGCGAGAAATCGGATAAACTATTACAACCCCTACAGTTTGATGAGTATA GAAATGGATCCACTCGTTATTCTCGGACGAGTGTTCAGTAATGAACCTCT GGAGAGAACCATGTATATGATCGTTATCTGGGTTGGACTTCTGCTTTTAA GCCCAGATAACTGGCCTGAATATGTTAATGAGAGAATCGGTATTCCTCAT GTGTGGCATGTTTTCGTCTTTGCTCTTGCATTTTCGCTAGCAATTAATGT GCATCGATTATCAGCTATTGCCAGCGCCAGATATAAGCGATTTAAGCTAA GAAAACGCATTAAGATGCAAAACGATAAAGTGCGATCAGTAATTCAAAAC CTTACAGAAGAGCAATCTATGGTTTTGTGCGCAGCCCTTAATGAAGGCAG GAAGTATGTGGTTACATCAAAACAATTCCCATACATTAGTGAGTTGATTG AGCTTGGTGTGTTGAACAAAACTTTTTCCCGATGGAATGGAAAGCATATA TTATTCCCTATTGAGGATATTTACTGGACTGAATTAGTTGCCAGCTATGA TCCATATAATATTGAGATAAAGCCAAGGCCAATATCTAAGTAACTAGATA AGAGGAATCGATTTTCCCTTAATTTTCTGGCGTCCACTGCATGTTATGCC GCGTTCGCCAGGCTTGCTGTACCATGTGCGCTGATTCTTGCGCTCAATAC GTTGCAGGTTGCTTTCAATCTGTTTGTGGTATTCAGCCAGCACTGTAAGG TCTATCGGATTTAGTGCGCTTTCTACTCGTGATTTCGGTTTGCGATTCAG CGAGAGAATAGGGCGGTTAACTGGTTTTGCGCTTACCCCAACCAACAGGG GATTTGCTGCTTTCCATTGAGCCTGTTTCTCTGCGCGACGTTCGCGGCGG CGTGTTTGTGCATCCATCTGGATTCTCCTGTCAGTTAGCTTTGGTGGTGT GTGGCAGTTGTAGTCCTGAACGAAAACCCCCCGCGATTGGCACATTGGCA GCTAATCCGGAATCGCACTTACGGCCAATGCTTCGTTTCGTATCACACAC CCCAAAGCCTTCTGCTTTGAATGCTGCCCTTCTTCAGGGCTTAATTTTTA AGAGCGTCACCTTCATGGTGGTCAGTGCGTCCTGCTGATGTGCTCAGTAT CACCGCCAGTGGTATTTATGTCAACACCGCCAGAGATAATTTATCACCGC AGATGGTTATCTGTATGTTTTTTATATGAATTTATTTTTTGCAGGGGGGC ATTGTTTGGTAGGTGAGAGATCTGAATTGCTATGTTTAGTGAGTTGTATC TATTTATTTTTCAATAAATACAATTGGTTATGTGTTTTGGGGGCGATCGT GAGGCAAAGAAAACCCGGCGCTGAGGCCGGGTTATTCTTGTTCTCTGGTC AAATTATATAGTTGGAAAACAAGGATGCATATATGAATGAACGATGCAGA GGCAATGCCGATGGCGATAGTGGGTATCATGTAGCCGCTTATGCTGGAAA GAAGCAATAACCCGCAGAAAAACAAAGCTCCAAGCTCAACAAAACTAAGG GCATAGACAATAACTACCGATGTCATATACCCATACTCTCTAATCTTGGC CAGTCGGCGCGTTCTGCTTCCGATTAGAAACGTCAAGGCAGCAATCAGGA TTGCAATCATGGTTCCTGCATATGATGACAATGTCGCCCCAAGACCATCT CTATGAGCTGAAAAAGAAACACCAGGAATGTAGTGGCGGAAAAGGAGATA GCAAATGCTTACGATAACGTAAGGAATTATTACTATGTAAACACCAGGCA TGATTCTGTTCCGCATAATTACTCCTGATAATTAATCCTTAACTTTGCCC ACCTGCCTTTTAAAACATTCCAGTATATCACTTTTCATTCTTGCGTAGCA ATATGCCATCTCTTCAGCTATCTCAGCATTGGTGACCTTGTTCAGAGGCG CTGAGAGATGGCCTTTTTCTGATAGATAATGTTCTGTTAAAATATCTCCG GCCTCATCTTTTGCCCGCAGGCTAATGTCTGAAAATTGAGGTGACGGGTT AAAAATAATATCCTTGGCAACCTTTTTTATATCCCTTTTAAATTTTGGCT TAATGACTATATCCAATGAGTCAAAAAGCTCCCCTTCAATATCTGTTGCC CCTAAGACCTTTAATATATCGCCAAATACAGGTAGCTTGGCTTCTACCTT CACCGTTGTTCGGCCGATGAAATGCATATGCATAACATCGTCTTTGGTGG TTCCCCTCATCAGTGGCTCTATCTGAACGCGCTCTCCACTGCTTAATGAC ATTCCTTTCCCGATTAAAAAATCTGTCAGATCGGATGTGGTCGGCCCGAA AACAGTTCTGGCAAAACCAATGGTGTCGCCTTCAACAAACAAAAAAGATG GGAATCCCAATGATTCGTCATCTGCGAGGCTGTTCTTAATATCTTCAACT GAAGCTTTAGAGCGATTTATCTTCTGAACCAGACTCTTGTCATTTGTTTT GGTAAAGAGAAAAGTTTTTCCATCGATTTTATGAATATACAAATAATTGG AGCCAACCTGCAGGTGATGATTATCAGCCAGCAGAGAATTAAGGAAAACA GACAGGTTTATTGAGCGCTTATCTTTCCCTTTATTTTTGCTGCGGTAAGT CGCATAAAAACCATTCTTCATAATTCAATCCATTTACTATGTTATGTTCT GAGGGGAGTGAAAATTCCCCTAATTCGATGAAGATTCTTGCTCAATTGTT ATCAGCTATGCGCCGACCAGAACACCTTGCCGATCAGCCAAACGTCTCTT CAGGCCACTGACTAGCGATAACTTTCCCCACAACGGAACAACTCTCATTG CATGGGATCATTGGGTACTGTGGGTTTAGTGGTTGTAAAAACACCTGACC GCTATCCCTGATCAGTTTCTTGAAGGTAAACTCATCACCCCCAAGTCTGG CTATGCAGAAATCACCTGGCTCAACAGCCTGCTCAGGGTCAACGAGAATT AACATTCCGTCAGGAAAGCTTGGCTTGGAGCCTGTTGGTGCGGTCATGGA ATTACCTTCAACCTCAAGCCAGAATGCAGAATCACTGGCTTTTTTGGTTG TGCTTACCCATCTCTCCGCATCACCTTTGGTAAAGGTTCTAAGCTCAGGT GAGAACATCCCTGCCTGAACATGAGAAAAAACAGGGTACTCATACTCACT TCTAAGTGACGGCTGCATACTAACCGCTTCATACATCTCGTAGATTTCTC TGGCGATTGAAGGGCTAAATTCTTCAACGCTAACTTTGAGAATTTTTGCA AGCAATGCGGCGTTATAAGCATTTAATGCATTGATGCCATTAAATAAAGC ACCAACGCCTGACTGCCCCATCCCCATCTTGTCTGCGACAGATTCCTGGG ATAAGCCAAGTTCATTTTTCTTTTTTTCATAAATTGCTTTAAGGCGACGT GCGTCCTCAAGCTGCTCTTGTGTTAATGGTTTCTTTTTTGTGCTCATACG TTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACT ATTTTACCTCTGGCGGTGATAATGGTTGCATGTACTAAGGAGGTTGTATG GAACAACGCATAACCCTGAAAGATTATGCAATGCGCTTTGGGCAAACCAA GACAGCTAAAGATCTCGGCGTATATCAAAGCGCGATCAACAAGGCCATTC ATGCAGGCCGAAAGATTTTTTTAACTATAAACGCTGATGGAAGCGTTTAT GCGGAAGAGGTAAAGCCCTTCCCGAGTAACAAAAAAACAACAGCATAAAT AACCCCGCTCTTACACATTCCAGCCCTGAAAAAGGGCATCAAATTAAACC ACACCTATGGTGTATGCATTTATTTGCATACATTCAATCAATTGTTATCT AAGGAAATACTTACATATGGTTCGTGCAAACAAACGCAACGAGGCTCTAC GAATCGAGAGTGCGTTGCTTAACAAAATCGCAATGCTTGGAACTGAGAAG ACAGCGGAAGCTGTGGGCGTTGATAAGTCGCAGATCAGCAGGTGGAAGAG GGACTGGATTCCAAAGTTCTCAATGCTGCTTGCTGTTCTTGAATGGGGGG TCGTTGACGACGACATGGCTCGATTGGCGCGACAAGTTGCTGCGATTCTC ACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTCTGAACAAATCCAGAT GGAGTTCTGAGGTCATTACTGGATCTATCAACAGGAGTCATTATGACAAA TACAGCAAAAATACTCAACTTCGGCAGAGGTAACTTTGCCGGACAGGAGC GTAATGTGGCAGATCTCGATGATGGTTACGCCAGACTATCAAATATGCTG CTTGAGGCTTATTCGGGCGCAGATCTGACCAAGCGACAGTTTAAAGTGCT GCTTGCCATTCTGCGTAAAACCTATGGGTGGAATAAACCAATGGACAGAA TCACCGATTCTCAACTTAGCGAGATTACAAAGTTACCTGTCAAACGGTGC AATGAAGCCAAGTTAGAACTCGTCAGAATGAATATTATCAAGCAGCAAGG CGGCATGTTTGGACCAAATAAAAACATCTCAGAATGGTGCATCCCTCAAA ACGAGGGAAAATCCCCTAAAACGAGGGATAAAACATCCCTCAAATTGGGG GATTGCTATCCCTCAAAACAGGGGGACACAAAAGACACTATTACAAAAGA AAAAAGAAAAGATTATTCGTCAGAGAATTCTGGCGAATCCTCTGACCAGC CAGAAAACGACCTTTCTGTGGTGAAACCGGATGCTGCAATTCAGAGCGGC AGCAAGTGGGGGACAGCAGAAGACCTGACCGCCGCAGAGTGGATGTTTGA CATGGTGAAGACTATCGCACCATCAGCCAGAAAACCGAATTTTGCTGGGT GGGCTAACGATATCCGCCTGATGCGTGAACGTGACGGACGTAACCACCGC GACATGTGTGTGCTGTTCCGCTGGGCATGCCAGGACAACTTCTGGTCCGG TAACGTGCTGAGCCCGGCCAAACTCCGCGATAAGTGGACCCAACTCGAAA TCAACCGTAACAAGCAACAGGCAGGCGTGACAGCCAGCAAACCAAAACTC GACCTGACAAACACAGACTGGATTTACGGGGTGGATCTATGAAAAACATC GCCGCACAGATGGTTAACTTTGACCGTGAGCAGATGCGTCGGATCGCCAA CAACATGCCGGAACAGTACGACGAAAAGCCGCAGGTACAGCAGGTAGCGC AGATCATCAACGGTGTGTTCAGCCAGTTACTGGCAACTTTCCCGGCGAGC CTGGCTAACCGTGACCAGAACGAAGTGAACGAAATCCGTCGCCAGTGGGT TCTGGCTTTTCGGGAAAACGGGATCACCACGATGGAACAGGTTAACGCAG GAATGCGCGTAGCCCGTCGGCAGAATCGACCATTTCTGCCATCACCCGGG CAGTTTGTTGCATGGTGCCGGGAAGAAGCATCCGTTACCGCCGGACTGCC AAACGTCAGCGAGCTGGTTGATATGGTTTACGAGTATTGCCGGAAGCGAG GCCTGTATCCGGATGCGGAGTCTTATCCGTGGAAATCAAACGCGCACTAC TGGCTGGTTACCAACCTGTATCAGAACATGCGGGCCAATGCGCTTACTGA TGCGGAATTACGCCGTAAGGCCGCAGATGAGCTTGTCCATATGACTGCGA GAATTAACCGTGGTGAGGCGATCCCTGAACCAGTAAAACAACTTCCTGTC ATGGGCGGTAGACCTCTAAATCGTGCACAGGCTCTGGCGAAGATCGCAGA AATCAAAGCTAAGTTCGGACTGAAAGGAGCAAGTGTATGACGGGCAAAGA GGCAATTATTCATTACCTGGGGACGCATAATAGCTTCTGTGCGCCGGACG TTGCCGCGCTAACAGGCGCAACAGTAACCAGCATAAATCAGGCCGCGGCT AAAATGGCACGGGCAGGTCTTCTGGTTATCGAAGGTAAGGTCTGGCGAAC GGTGTATTACCGGTTTGCTACCAGGGAAGAACGGGAAGGAAAGATGAGCA CGAACCTGGTTTTTAAGGAGTGTCGCCAGAGTGCCGCGATGAAACGGGTA TTGGCGGTATATGGAGTTAAAAGATGACCATCTACATTACTGAGCTAATA ACAGGCCTGCTGGTAATCGCAGGCCTTTTTATTTGGGGGAGAGGGAAGTC ATGAAAAAACTAACCTTTGAAATTCGATCTCCAGCACATCAGCAAAACGC TATTCACGCAGTACAGCAAATCCTTCCAGACCCAACCAAACCAATCGTAG TAACCATTCAGGAACGCAACCGCAGCTTAGACCAAAACAGGAAGCTATGG GCCTGCTTAGGTGACGTCTCTCGTCAGGTTGAATGGCATGGTCGCTGGCT GGATGCAGAAAGCTGGAAGTGTGTGTTTACCGCAGCATTAAAGCAGCAGG ATGTTGTTCCTAACCTTGCCGGGAATGGCTTTGTGGTAATAGGCCAGTCA ACCAGCAGGATGCGTGTAGGCGAATTTGCGGAGCTATTAGAGCTTATACA GGCATTCGGTACAGAGCGTGGCGTTAAGTGGTCAGACGAAGCGAGACTGG CTCTGGAGTGGAAAGCGAGATGGGGAGACAGGGCTGCATGATAAATGTCG TTAGTTTCTCCGGTGGCAGGACGTCAGCATATTTGCTCTGGCTAATGGAG CAAAAGCGACGGGCAGGTAAAGACGTGCATTACGTTTTCATGGATACAGG TTGTGAACATCCAATGACATATCGGTTTGTCAGGGAAGTTGTGAAGTTCT GGGATATACCGCTCACCGTATTGCAGGTTGATATCAACCCGGAGCTTGGA CAGCCAAATGGTTATACGGTATGGGAACCAAAGGATATTCAGACGCGAAT GCCTGTTCTGAAGCCATTTATCGATATGGTAAAGAAATATGGCACTCCAT ACGTCGGCGGCGCGTTCTGCACTGACAGATTAAAACTCGTTCCCTTCACC AAATACTGTTGATGACCaTTTCGGGCGAGGGAATTACACCACGTGGATTG GCATCAGAGCTGATGAACCGAAGCGGCTAAAGCCAAAGCCTGGAATCAGA TATCTTGCTGAACTGTCAGACTTTGAGAAGGAAGATATCCTCGCATGGTG GAAGCAACAACCATTCGATTTGCAAATACCGGAACATCTCGGTAACTGCA TATTCTGCATTAAAAAATCAACGCAAAAAATCGGACTTGCCTGCAAAGAT GAGGAGGGATTGCAGCGTGTTTTTAATGAGGTCATCACGGGATCCCATGT GCGTGACGGACATCGGGAAACGCCAAAGGAGATTATGTACCGAGGAAGAA TGTCGCTGGACGGTATCGCGAAAATGTATTCAGAAAATGATTATCAAGCC CTGTATCAGGACATGGTACGAGCTAAAAGATTCGATACCGGCTCTTGTTC TGAGTCATGCGAAATATTTGGAGGGCAGCTTGATTTCGACTTCGGGAGGG AAGCTGCATGATGCGATGTTATCGGTGCGGTGAATGCAAAGAAGATAACC GCTTCCGACCAAATCAACCTTACTGGAATCGATGGTGTCTCCGGTGTGAA AGAACACCAACAGGGGTGTTACCACTACCGCAGGAAAAGGAGGACGTGTG GCGAGACAGCGACGAAGTATCACCGACATAATCTGCGAAAACTGCAAATA CCTTCCAACGAAACGCACCAGAAATAAACCCAAGCCAATCCCAAAAGAAT CTGACGTAAAAACCTTCAACTACACGGCTCACCTGTGGGATATCCGGTGG CTAAGACGTCGTGCGAGGAAAACAAGGTGATTGACCAAAATCGAAGTTAC GAACAAGAAAGCGTCGAGCGAGCTTTAACGTGCGCTAACTGCGGTCAGAA GCTGCATGTGCTGGAAGTTCACGTGTGTGAGCACTGCTGCGCAGAACTGA TGAGCGATCCGAATAGCTCGATGCACGAGGAAGAAGATGATGGCTAAACC AGCGCGAAGACGATGTAAAAACGATGAATGCCGGGAATGGTTTCACCCTG CATTCGCTAATCAGTGGTGGTGCTCTCCAGAGTGTGGAACCAAGATAGCA CTCGAACGACGAAGTAAAGAACGCGAAAAAGCGGAAAAAGCAGCAGAGAA GAAACGACGACGAGAGGAGCAGAAACAGAAAGATAAACTTAAGATTCGAA AACTCGCCTTAAAGCCCCGCAGTTACTGGATTAAACAAGCCCAACAAGCC GTAAACGCCTTCATCAGAGAAAGAGACCGCGACTTACCATGTATCTCGTG CGGAACGCTCACGTCTGCTCAGTGGGATGCCGGACATTACCGGACAACTG CTGCGGCACCTCAACTCCGATTTAATGAACGCAATATTCACAAGCAATGC GTGGTGTGCAACCAGCACAAAAGCGGAAATCTCGTTCCGTATCGCGTCGA ACTGATTAGCCGCATCGGGCAGGAAGCAGTAGACGAAATCGAATCAAACC ATAACCGCCATCGCTGGACTATCGAAGAGTGCAAGGCGATCAAGGCAGAG TACCAACAGAAACTCAAAGACCTGCGAAATAGCAGAAGTGAGGCCGCATG ACGTTCTCAGTAAAAACCATTCCAGACATGCTCGTTGAAGCATACGGAAA TCAGACAGAAGTAGCACGCAGACTGAAATGTAGTCGCGGTACGGTCAGAA AATACGTTGATGATAAAGACGGGAAAATGCACGCCATCGTCAACGACGTT CTCATGGTTCATCGCGGATGGAGTGAAAGAGATGCGCTATTACGAAAAAA TTGATGGCAGCAAATACCGAAATATTTGGGTAGTTGGCGATCTGCACGGA TGCTACACGAACCTGATGAACAAACTGGATACGATTGGATTCGACAACAA AAAAGACCTGCTTATCTCGGTGGGCGATTTGGTTGATCGTGGTGCAGAGA ACGTTGAATGCCTGGAATTAATCACATTCCCCTGGTTCAGAGCTGTACGT GGAAACCATGAGCAAATGATGATTGATGGCTTATCAGAGCGTGGAAACGT TAATCACTGGCTGCTTAATGGCGGTGGCTGGTTCTTTAATCTCGATTACG ACAAAGAAATTCTGGCTAAAGCTCTTGCCCATAAAGCAGATGAACTTCCG TTAATCATCGAACTGGTGAGCAAAGATAAAAAATATGTTATCTGCCACGC CGATTATCCCTTTGACGAATACGAGTTTGGAAAGCCAGTTGATCATCAGC AGGTAATCTGGAACCGCGAACGAATCAGCAACTCACAAAACGGGATCGTG AAAGAAATCAAAGGCGCGGACACGTTCATCTTTGGTCATACGCCAGCAGT GAAACCACTCAAGTTTGCCAACCAAATGTATATCGATACCGGCGCAGTGT TCTGCGGAAACCTAACATTGATTCAGGTACAGGGAGAAGGCGCATGAGAC TCGAAAGCGTAGCTAAATTTCATTCGCCAAAAAGCCCGATGATGAGCGAC TCACCACGGGCCACGGCTTCTGACTCTCTTTCCGGTACTGATGTGATGGC TGCTATGGGGATGGCGCAATCACAAGCCGGATTCGGTATGGCTGCATTCT GCGGTAAGCACGAACTCAGCCAGAACGACAAACAAAAGGCTATCAACTAT CTGATGCAATTTGCACACAAGGTATCGGGGAAATACCGTGGTGTGGCAAA GCTTGAAGGAAATACTAAGGCAAAGGTACTGCAAGTGCTCGCAACATTCG CTTATGCGGATTATTGCCGTAGTGCCGCGACGCCGGGGGCAAGATGCAGA GATTGCCATGGTACAGGCCGTGCGGTTGATATTGCCAAAACAGAGCTGTG GGGGAGAGTTGTCGAGAAAGAGTGCGGAAGATGCAAAGGCGTCGGCTATT CAAGGATGCCAGCAAGCGCAGCATATCGCGCTGTGACGATGCTAATCCCA AACCTTACCCAACCCACCTGGTCACGCACTGTTAAGCCGCTGTATGACGC TCTGGTGGTGCAATGCCACAAAGAAGAGTCAATCGCAGACAACATTTTGA ATGCGGTCACACGTTAGCAGCATGATTGCCACGGATGGCAACATATTAAC GGCATGATATTGACTTATTGAATAAAATTGGGTAAATTTGACTCAACGAT GGGTTAATTCGCTCGTTGTGGTAGTGAGATGAAAAGAGGCGGCGCTTACT ACCGATTCCGCCTAGTTGGTCACTTCGACGTATCGTCTGGAACTCCAACC ATCGCAGGCAGAGAGGTCTGCAAAATGCAATCCCGAAACAGTTCGCAGGT AATAGTTAGAGCCTGCATAACGGTTTCGGGATTTTTTATATCTGCACAAC AGGTAAGAGCATTGAGTCGATAATCGTGAAGAGTCGGCGAGCCTGGTTAG CCAGTGCTCTTTCCGTTGTGCTGAATTAAGCGAATACCGGAAGCAGAACC GGATCACCAAATGCGTACAGGCGTCATCGCCGCCCAGCAACAGCACAACC CAAACTGAGCCGTAGCCACTGTCTGTCCTGAATTCATTAGTAATAGTTAC GCTGCGGCCTTTTACACATGACCTTCGTGAAAGCGGGTGGCAGGAGGTCG CGCTAACAACCTCCTGCCGTTTTGCCCGTGCATATCGGTCACGAACAAAT CTGATTACTAAACACAGTAGCCTGGATTTGTTCTATCAGTAATCGACCTT ATTCCTAATTAAATAGAGCAAATCCCCTTATTGGGGGTAAGACATGAAGA TGCCAGAAAAACATGACCTGTTGGCCGCCATTCTCGCGGCAAAGGAACAA GGCATCGGGGCAATCCTTGCGTTTGCAATGGCGTACCTTCGCGGCAGATA TAATGGCGGTGCGTTTACAAAAACAGTAATCGACGCAACGATGTGCGCCA TTATCGCCTGGTTCATTCGTGACCTTCTCGACTTCGCCGGACTAAGTAGC AATCTCGCTTATATAACGAGCGTGTTTATCGGCTACATCGGTACTGACTC GATTGGTTCGCTTATCAAACGCTTCGCTGCTAAAAAAGCCGGAGTAGAAG ATGGTAGAAATCAATAATCAACGTAAGGCGTTCCTCGATATGCTGGCGTG GTCGGAGGGAACTGATAACGGACGTCAGAAAACCAGAAATCATGGTTATG ACGTCATTGTAGGCGGAGAGCTATTTACTGATTACTCCGATCACCCTCGC AAACTTGTCACGCTAAACCCAAAACTCAAATCAACAGGCGCCGGACGCTA CCAGCTTCTTTCCCGTTGGTGGGATGCCTACCGCAAGCAGCTTGGCCTGA AAGACTTCTCTCCGAAAAGTCAGGACGCTGTGGCATTGCAGCAGATTAAG GAGCGTGGCGCTTTACCTATGATTGATCGTGGTGATATCCGTCAGGCAAT CGACCGTTGCAGCAATATCTGGGCTTCACTGCCGGGCGCTGGTTATGGTC AGTTCGAGCATAAGGCTGACAGCCTGATTGCAAAATTCAAAGAAGCGGGC GGAACGGTCAGAGAGATTGATGTATGAGCAGAGTCACCGCGATTATCTCC GCTCTGGTTATCTGCATCATCGTCTGCCTGTCATGGGCTGTTAATCATTA CCGTGATAACGCCATTACCTACAAAGCCCAGCGCGACAAAAATGCCAGAG AACTGAAGCTGGCGAACGCGGCAATTACTGACATGCAGATGCGTCAGCGT GATGTTGCTGCGCTCGATGCAAAATACACGAAGGAGTTAGCTGATGCTAA AGCTGAAAATGATGCTCTGCGTGATGATGTTGCCGCTGGTCGTCGTCGGT TGCACATCAAAGCAGTCTGTCAGTCAGTGCGTGAAGCCACCACCGCCTCC GGCGTGGATAATGCAGCCTCCCCCCGACTGGCAGACACCGCTGAACGGGA TTATTTCACCCTCAGAGAGAGGCTGATCACTATGCAAAAACAACTGGAAG GAACCCAGAAGTATATTAATGAGCAGTGCAGATAGAGTTGCCCATATCGA TGGGCAACTCATGCAATTATTGTGAGCAATACACACGCGCTTCCAGCGGA GTATAAATGCCTAAAGTAATAAAACCGAGCAATCCATTTACGAATGTTTG CTGGGTTTCTGTTTTAACAACATTTTCTGCGCCGCCACAAATTTTGGCTG CATCGACAGTTTTCTTCTGCCCAATTCCAGAAACGAAGAAATGATGGGTG ATGGTTTCCTTTGGTGCTACTGCTGCCGGTTTGTTTTGAACAGTAAACGT CTGTTGAGCACATCCTGTAATAAGCAGGGCCAGCGCAGTAGCGAGTAGCA TTTTTTTCATGGTGTTATTCCCGATGCTTTTTGAAGTTCGCAGAATCGTA TGTGTAGAAAATTAAACAAACCCTAAACAATGAGTTGAAATTTCATATTG TTAATATTTATTAATGTATGTCAGGTGCGATGAATCGTCATTGTATTCCC GGATTAACTATGTCCACAGCCCTGACGGGGAACTTCTCTGCGGGAGTGTC CGGGAATAATTAAAACGATGCACACAGGGTTTAGCGCGTACACGTATTGC ATTATGCCAACGCCCCGGTGCTGACACGGAAGAAACCGGACGTTATGATT TAGCGTGGAAAGATTTGTGTAGTGTTCTGAATGCTCTCAGTAAATAGTAA TGAATTATCAAAGGTATAGTAATATCTTTTATGTTCATGGATATTTGTAA CCCATCGGAAAACTCCTGCTTTAGCAAGATTTTCCCTGTATTGCTGAAAT GTGATTTCTCTTGATTTCAACCTATCATAGGACGTTTCTATAAGATGCGT GTTTCTTGAGAATTTAACATTTACAACCTTTTTAAGTCCTTTTATTAACA CGGTGTTATCGTTTTCTAACACGATGTGAATATTATCTGTGGCTAGATAG TAAATATAATGTGAGACGTTGTGACGTTTTAGTTCAGAATAAAACAATTC ACAGTCTAAATCTTTTCGCACTTGATCGAATATTTCTTTAAAAATGGCAA CCTGAGCCATTGGTAAAACCTTCCATGTGATACGAGGGCGCGTAGTTTGC ATTATCGTTTTTATCGTTTCAATCTGGTCTGACCTCCTTGTGTTTTGTTG ATGATTTATGTCAAATATTAGGAATGTTTTCACTTAATAGTATTGGTTGC GTAACAAAGTGCGGTCCTGCTGGCATTCTGGAGGGAAATACAACCGACAG ATGTATGTAAGGCCAACGTGCTCAAATCTTCATACAGAAAGATTTGAAGT AATATTTTAACCGCTAGATGAAGAGCAAGCGCATGGAGCGACAAAATGAA TAAAGAACAATCTGCTGATGATCCCTCCGTGGATCTGATTCGTGTAAAAA ATATGCTTAATAGCACCATTTCTATGAGTTACCCTGATGTTGTAATTGCA TGTATAGAACATAAGGTGTCTCTGGAAGCATTCAGAGCAATTGAGGCAGC GTTGGTGAAGCACGATAATAATATGAAGGATTATTCCCTGGTGGTTGACT GATCACCATAACTGCTAATCATTCAAACTATTTAGTCTGTGACAGAGCCA ACACGCAGTCTGTCACTGTCAGGAAAGTGGTAAAACTGCAACTCAATTAC TGCAATGCCCTCGTAATTAAGTGAATTTACAATATCGTCCTGTTCGGAGG GAAGAACGCGGGATGTTCATTCTTCATCACTTTTAATTGATGTATATGCT CTCTTTTCTGACGTTAGTCTCCGACGGCAGGCTTCAATGACCCAGGCTGA GAAATTCCCGGACCCTTTTTGCTCAAGAGCGATGTTAATTTGTTCAATCA TTTGGTTAGGAAAGCGGATGTTGCGGGTTGTTGTTCTGCGGGTTCTGTTC TTCGTTGACATGAGGTTGCCCCGTATTCAGTGTCGCTGATTTGTATTGTC TGAAGTTGTTTTTACGTTAAGTTGATGCAGATCAATTAATACGATACCTG CGTCATAATTGATTATTTGACGTGGTTTGATGGCCTCCACGCACGTTGTG ATATGTAGATGATAATCATTATCACTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACG



Back to DNA page
Back to Homepage