Phage 186 complete genome

- Reference:

there is no reference covering the complete genome sequence. GenBank file



ggcgtggcggggaaagcattgcgcgccagaggtggcgcgtgaatgataaa aattatcgtctgagcgcctcgtaatggcgctatcgtggtgctgttggttc gttggtggtcgtgtgtgtttgtgcgcgtgtggcgcgtctgagacgtgatg gtggcggggtatgaaaaagccgccatgctggcggcttgagagggattatt ccgggttgtcgagggtgtactctttgaacctgatgacctccatgccgagc cagtcgtttacctccctgaacctgtcctgcagcggcgacaggtcgttacg cacaaatacctttgccactttctcaacgtcaccgagcgagccgatattct cgggcttgccgcccatgagctggaacggtacgcggtgcgcgtccatcagg tcggcggcgctggctttcttgatgttgaaaaagtcatcctttgtggcgac ctcgctcagtggcacgattttaatgccgtccggttttccattgggagcgt agaaaaacaggtttttaaaattgccgagccctttcgagttgcgcatcgcc tcgcgcagcgattcgacgtcggtcgcgctctgcgccgggtcggtcacata catgatgtaacccgcatgcgcgccgttctggtaatacttgcggcggaaca gcgttgcggattcattcagccaggcggaattaagcgcgctgagatattcg ggcaggccgtaaatctcctgattaatgtcgggctccagcaggtgaaacac ggtatcaggcgcgaattcatgcggcagagtgaagttttccacaaaccaga aaaccgaatcgtcgaccccgcggcgggtgtatttggccggtgaggccagt agcttgattagctggccggtaacgctgtggcgctgctcaagaaaggcgtt gccgaataccagatagtcgagcgcaaagcggctgaaatcctgacgggaca gcagcgggtgcgggatgtaggtgctcgcgagcacgttgcgcttaacgtaa atcggtgagctgtgatgtacagcagagcgcaggctctttgccagcccgga gaagctgaccggcggctcgtaccatttgccgttactgatgcactcgacat aatccagaatgtcgcgcttatcgagtaccggcactggctcgccaaaggtg aacgcctccattttttgcggggcgctggcggtcatggctacctgtttgcg tggcttgcgcttgctcatgctgccacctcacccgctgcaacagcgaaaga ccagtcgcagccaaacagcaggcgataatcatcgtcgctgtattcgtgtt taatttcatcgggcgcaaagagattgcacccgcgctggcatgctgcatcc agagtgaccgactgacgccagacaccatctgtacaaaatacgctgtcgcc ggtattgatgagcggtgacggtcggtgcctgcgggttgtgccgttccata ccctgaaagcgtcataattatcagagggcgaggtaaacatcgtcaggctg tggcgtttatggcaggcgatacccgccgcgactttcgcagctcttagcgg gttattgaaccatccgaactcatcaagatagacattacccgccagtgcgg cgcaatgggattcctcgccgacaaagctgataaccgcaccgtcgtcgagc tgcaggctgtggccgttactcgtaagactgacgccgacgcgcgccgaaag gttactcatgtacatcagcgccacgcgcgcatgctcaatagtgtgagcaa accagacatgattatcgcctgttgtcagcgcatcgagcagcgcctcacgg ctaaagagctgcgttgcgccaatctggcgcgatttggtgatgctgcggtc gatattgagtttcccgacacgcaaccatgttgcctgatagtcaaagctgt cattgtgcagaatatcggccattgcctgaatctggctttgtgagaaaacg ttatttttcattaattaaactccagaatggatttaggctgtatgccgcta ccggcggaaagcggttcgtttaacagggcgtgcatggtcgcccatgcaat atcggcgtgactggcttcctcggtgcggctggcctcgtaggtggcgctgc gcccgctgctggtcatggttttgcggatggacataaacgactgcgtgacg tcggttgctccggcgtcgtactccagacagccgcggcgaatggtgtcttt tgccttgagtaccattgcggttttcatttcaggcgtgtaacggatgccgc gtgcggccgggtagaatgagcgcaccaactggaacacgccgaggccgagg ccggttgcgtcaatgccgatgtattcgacgctgtatttctcggtcagttt gcggatgccatctgcctgcgcggcaaagtccatgcccttccactggtggc gctccagcatgcggaacttgccaccagaaaccaccggcggcgcgagcacg acgcacccggcgctgtcgccagtgtgtgacgggtcgtagccaatccagac ggggcgagagccgaacggatggtcggcgaacggggcgaagtcctcccatt cttccatcacgtcgaccatgcagcgctgcagctcctcgaacgggaatacc gacgctttatcgtcgacaaactcgcacataaacaggtttttaaagtcctc atcactgttttcgcgtttgagttggtcgaggtcgaacagggtgcagccac cggcaagggcgtcctcaatggtgacaatctgccgccactggccatcgtcg cagagctggccaccggcgagcgcgcggtgactgatgtcaatttcgatgcg gtcggcaatacggctgcgccccttgttgaacagctcgccagaccagaagg gataagcgccgtgcgccagcgttgagggtgtcgaaaagtaggttgagcgc agatgcttctgcgaggccatgcccgaggcgactttgcgcagcttctgaaa attcgggatccagaatatttcatcgacatacaggtcgccgttatggctct gagccgtgttggagttggtaccgagaaaaatcagctttgcgccgttgttg ccaatgacaatcgggtcgccggtcaggtcgacgtcaaccagtcgcgcaaa ctgtatgatgtattcgcggaacacgtaagcctgcgttttactggccgaca gaaaaatctggttatggccggtcttgagtgctcgcagcagtgcctcacgg gaaaaatagaacgtcgcgccaatctggcgggatttgagaatgtcgcgaat acggtgtgccagtcctgcgcggtaccactgcaactggtactcgaaagact ggtcgaaaaataattcctccagcttttcgatagcctcgtcgctgaaaaaa ttctttttcggcttcttgcgctcacccttgttgcggttggcgacgttggg gttaaggtcggcctcgttgccggtctggctgtagcggttaacgcgtgcca gtcgttcaatctgccgcccgagcaggtcaatctctttgaagtcaccgcct gacttttgcggcttggcgatgagctgaatcaggcgcgcctcaaggctgct ttcaacgcgggaaatcggtgcgatgccatcccagccgtcgcgctgtttcc agctctgcacggtcgggcgcttgacctgcagcatttcggcaatctgcggc acggaaaaaccctgccagtaaagcagcgatgcctgtcgtcgcgggtcatg caacaaggttgtatcggtggaaatggtcattgatgcctcgccgtaatgga ttcagggcaaggctacttaatggccgtcagtgattcgctaaggtgctgtt gtgtgggcggttgtccagtcgtcattggtggtctggcgtgtcctgagtct ggaaactggcggtgaccagtaaccccaacctcaggactcctgacaatggc aaaaaaagtctcaaaattctttcgaatcggcgtcgagggtgatacctgcg acgggcgcattatcagcgccagtgatattcaggaaatggccgaaacctat gacccgcgtgtttacggttgccgtatcaaccttgaacacctgcgcggcct gttgcccgatggcatattcaagcgttacggcgatgtggtcgagctgaaag ccgagaagattgacgacgattctgcgcttaacggcaagtgggcgttgttc gctaaaatcaccccgaccgatgaccttatcgcgatgaataaagccgcgca gaaggtctacacctcaatggaaattcagccgaattttgccaataccggca aatgctacctcgtcggccttgctgtcaccgatgacccggcgagcctcggc actgaatatctcgaattctgccgcactgcgaagcacaacccgctgcagcg ctttaaagcccaccctgaaaacgtcttttccgccgccacgctggccgaac tggaatttgaagacgttcccgacacggtgctcaacagcctggccgataag gtgaaagccattttcagccgtaagcaggtcagcgacgatgcgcgcctgaa tgatgtacatgaagcggtgaccgccgtcagcgagcatgtgcagaccaacc tcactgcacaggataagcgtctttccgatatggaaaccgcgtttgccacc ttcaaacaggaactgaccggcaaggttgaagaaaccagccaggcattttc cgtcctgaaaaccactctcgacaaaaccgaaagtttcagccagccgcgac gcacgaaagccagcggcggtggtggcgatgagctgctgactgactgctga taaaccgcagaccgaaaccgggcggaacccccgcccgatgctgtgactaa ccgattaaatcaaacaggaaatactatgcgtcaggaaacccgttttaagt tcaatgcctatctgacccagctcgccaaactgaacggcatcagcgttgat gacgtcagcaaaaaattcaccgtcgagccgtccgtcacgcaaacgctgat gaacaccgtgcaggcgtcatccgcgtttctgcagatgattaacattctgc cggtcgcagaaatgaagggtgagaaaatcggtgtcggtgtgaccggcacc atcgccagcacgaccgacacctcgggcgacaaagagcgccagaccgcaga ttttaccgcgcttgagtccaacaagtacgagtgcaaccagattaactttg acttccacctgacctataaacgcctcgacctgtgggcgcgttttcaggac tttcagcgtcgtattcgcgacgccattgtccagcgtcaggcactggattt catcatggccgggtttaacggtaccacccgcgctgacacctctgaccgtg ttaaaaacccgatgctgcaggatgtggccgttggctggctgcagaaatac cgcaatgaagccccggcgcgtgtgatgagcaacatcaccgacgctgacgg taaagtcgtttcggcagtgattcgcgtcggtaaaaacggcgactatgaga acctcgacgcactggtgatggatggtaccaataccctgattgacgagatt tatcaggatgacccgaaactcgttgccatcgttggccgtaagctgctggc cgacaaatattttccgctggtcaacaaacagcaggaaaacaccgagtcgc tcgcggcggatatcatcatcagccagaagcgcatcggcaacctgccagcc gtacgtgtgccgtacttcccggcgaacgcggtgttcgtgaccacgctgga aaacctctctatctatttcatggatgagagccaccgccgcagcattgatg aaaacccgaaaaaagaccgcgtggaaaactacgagtcgatgaacatcgac tatgtggtcgaggcgtatgccgccgggtgcctgctggaaaacatcaccct gggcgatttcaccgcacctgcagcaccggaaggcggagagtaaacccatg acgagccccgcacagcgtcacatgatgcgggtctcggcctctcaagccgc gcagcgggaacaagccccgctgcgccatgcaaccgcctatgagcagatgc tggttaagctggccgatgaccgccgcacgttaaaaaacatccgttcaaac gaacgtaaagccgagaaaaagcgcgagctgctgccgttctatgcgccgtg ggtcgccggtgtgctgactgatggtcgtggtgcgcaggatgacattgtta tgaccgtcatgctgtggcgtctcgatgccggtgatatcgctggcgcgctg gaaattgccccctacgcgctgaagtacggcctcacctctgaccatcgccg cacgacaccttacatgctggtcgaggaagtggcacttgccgcgcagcgcc tgcgcgatgccggtgagtctgtcgacctttcctggctgcaggccactatc gacctgaccgacggcgctgacgttcccgatatggtgcgcgcccgtctgca taaggtgacaggcctgaccctgcgtgatgccggtatgaatgcagaggcgc tggcgcagtttcagcgcgcgatgcagctcgaccgcaatgccggtgtgcgc aaggagattgagcgactggaacgggcattgaagccaaagacagaggccgc gccccgtaaaacgactaaaccgcgcacgcgtaaacctgccaccaaaccgg cagcaaagcgcgggcgtccaccaaaggcggcaaaaaccgccggttaactg aacgctccccgagccgggcggcacgccggtcaaagcaggcaaagacctga cggcgaccggcgtccaccgcccaacctgatgaggttgtcatgacgacagt gatactgaaccagcccgacgaaccgcaggacgtaccgggcgtggtgattc ccgcaccggagacgggcggtgcagtgattaaaaacacgttctttttccct gatgtggatccgaagcgcgtgcgcgaactgatgcgccttgagcagacggt ttccgatgcgcgcctgcgcaatgccatcaagaccggcatggccgagacca atgcggagctttacgactaccggctgcgccagactgccgccgggtttaag caactggccgacgtgcctgccgaggaaatcgacggcgagaatgtacgtgt tttccactatctgagtgctgtgacggcaatggcaaccgccaccctgtatg agcgctatcgcggcgttgaggccaccggcaaaggtgacaaaaaagccgac agcgtggaaaccaccattgatgacctgtggcgggatatgcgctggtcagt tgcgcgtctgcaggacaagccgcgctgcattgtggggcagctctgatgaa agtcaggtcgatgcagggcgataccctcgacacgatttgcgccaggtatt acgggcgcactgagggcgtggttgagacggtgctgcaggctaatccgggt ctgtctgagctgggtgtcattctgccgaatggtacagagattgacctgcc cgatgtggcatcgtcacccgtaactaaaactatcaacctttgggagtaac catgacagaaggtgaaaaaggcgtcctgtcactgtttgtgattggcgtga tgattgttgttgggaaagtgctggcaggcggtgaacccatcaccccgcgt ctgtttattggccgcatgctgctcggtggttttgtttcaatggtcgccgg tgttgttctggtgcagtttcctgacatgtcactgcccgccgtgtgcggga ttggatccatgctcggtattgccggttatcaggtggttgaaatcgccata cagcgccgctttaagtcacaaaagggggaaagtgatgccggtcattaaca ctcaccagaatatcgctgcgtttctggacatgctggcgtattccgaagga acagcgaaccatccgctgacgaaaaatcgtggctacgacgtcattgtcac tggccttgatggcagaccagagattttcaccgattacagcgaccaccctt tcgcgcatggccgaccaccgaaagtgtttaatcgccgtggcgagaaatcc acagcctcgggacgttaccagcagctttatctgttctggccgcactatca gaaacagctcgcattgcctgatttcagcccactgtcgcaggataagctcg cgatccagttaatccgggagcgcggtgctcttgacgatatccgggcgggg cgtattgagcgtgctgtttcacgttgtcgcaatatctgggcgtcattacc gggggccggttacggccagcgcgagcacggtctcgaaaagctggtcacca tctggcgcacggctggcggggtggtggcatgaaagtcctgataacgctgc ttgtgatggccgtgctcgggttgctgtggctgcaccatgagaacggcaat ttatcccgctcatttgagacggcaaaccgcgtcgcgagcgagcaaaagac gacgattgggatgctgaaaaatcagctcagtgttgccggtcagctcgccc gacgtaatgaatccgcgcaggtgacactgcgcgaacagctcgcaaaggca agtgcagaagccagccgccgtgagcagacgataacgaggttacttaatga aaatgaagcctttcgccgctggtataacgctgctctgcctgatgctgtgc gtcggctgcacacccgaacagcctgcgccagtgccggtgattgtggtcaa cggatgcccgagggtgagcctttgccctatgccgggaagtgacccgaaaa ccaatggtgacctgagcgcagatatccgccgtcttgagggggcgctgact gcctgcgcgctgcaggtcaaaaccgtcaaacactgtcaggatgaactcga tgcagaagcacaaaagcctgcgcaaagcgctgattaacgccgtgccgcag ctccgaaataaccccgatatgctgcgcctttttgccgacaacggccacac cgattcccgactggcgagctcgctgtcgtttgaaaaggtgtatgtgctta acgtggtggtgaccgactttactggcgacctcgatttgatattcgtgccg gtgcaggcatggctgcgtgaacatcagccggacattatgaccaccgacga cgggcgggaaaaaggattcacctggattattgatatcaataacgacgatt cgctcgatatcagtatcagcctgaggctcaccgagcgcacgctcgtcaaa gaggtcgggggcgcgctgcatgtcagttatgcaccagaaccgccactgcc tgagctggtgaagcgcccggttgctatgtatgcaaacggtgaattagtga gccagtgggatgagtgaattaaccgcgctgcaggagcgcctcgccggtct gattgccagcctgtcaccggcggcacgtcgcaaaatggcggctgagattg cgaaaaagctgcgtaccagtcagcagcagcgcatcaagcgccagcaggca cccgacggcaccccgtatgccgcacgaaagcgccagccggtacggagcaa gaaaggccgcattaagcgcgaaatgttcgccaaactgcgcaccagtcgct ttatgaaagccaaaggcagcgatagtgcggcggtggtggagtttaccggc aaggtgcagcgcatggcgcgggtgcatcagtacggcctcaaagaccgccc aaaccgcaacagccgggatgtgcagtacgaggcgcgcccgttgctcggtt tcacccgcgacgatgagcaaatgattgaagacgtcattatcagccacctc ggcaaataaatattgtgtgaaccaccaccggaggcgcgtgatttggcgcg gctaaagaccagaggcattctttgcactatgaatacgttatccacgatac aggagctcgcgcgtgcgattcgtaacctcatccgctcaggtgtggtgacg gaggtcgataccgtgcaggggctgtgccgcgtacaaagcggcgggatcca gacgacatggctgaactggctgaccacccgcgccggtcgttcgcgcacat ggtgggctccctcgctcggtgagcaggtgctgctgctggcaatcggtggc gagcttgataccgctttcgtgctgccggggattttctccgacgataaccc cgctccgtctgcctcggcggatgcgtggcatgtggtttttcctgatggcg cggtcattgagtacgagccggagaccagtgcactgacggtcagaggcatc aaaactgctgacgtgaccgcgtcggaatccatcacggccactgtgcctgt ggtgctggtgaaagcagaaacccgcatcaccctcgacaccccggaggtgg tatgcaccaacaaactgacgacggcaacgcttgaggtgcagaaaggcggg gagatgagaggcgacattgtccacaacggcggcacatttaaatcaaacgg tgtgcagctcgacgaccacggtcacggtggtgtgcaaagaggcggtgcct ggacggaggacaccaaatgacggcgcgctatatggggatgaaccgcaaca ccggtctcggtatcagtgacactgaacacatcagccagagcatgcgcgac attctgctgacgccggtcggctcgcgggtgatgcgtcgtgaatatggctc gctcctgtctgcgctgattgatatgccgcaaaacccggcgctcaggctgc aaatcatggtggcgtgctattcggccatccagaagtgggagccgcgtatc aggcttacatccatcagctttgagactggtgatgctggcgagatgtatgt cgatattaccgggatgcgtaccgatacgggtgcgtcagtttcaaccactg tttcactgagttaaatcactatggcaactgttgacctgagcctgttaccc gttcccgatgtggttgaggaactggattttgaaaccatccttgcggaacg cattgcgacgctaatttcgctataccccgaagaccagcaggaagctgtag cccggacgctcgcacttgagtctgaaccaattgttaaattgctgcaggaa aacgcctaccgtgaggttatctggcgtcagcgtgttaatgaagctgctcg cgcaggcatgctggcttatgccagagatagcgacctcgataatctcgggg cgaatttcaatgttgagcgcctggtcgtcaggcctgctgatgacaccacc atccccccgacccccgctgaaatggagcttgatgccgattttcgtctgcg tatacagcaggcatttgaagggatgagcgttgcgggatccaccggagctt atgaatttcatggccgcagtgctgacgggcgtgtcgcagatatttctgtt atcagcccttccccagcatgtgtcacgatatctgtgctttcgcgtgagaa taacggtgcggcgtctgatgagcttcagagcatcgtgcgcaatgcgctga atgctgaggacgtgaggccggttgctgaccgggttacagtgcagtcagct cagattattgactaccagatacgcgcaacacttttcgtttatccggggcc ggaaaatgagccgattcgtgcggcggctgaggcgaagctcaaagcttata tcagtgcacagcacaggttggggcgggatattcgcctgtcagcaatttat gccgcgttgcatgttgagggggtgcaacgtgtcgaactggctgcacctgt ggccgacattgtgcttgataaaacgcaggcatctttttgcacagactatc agatagtgattggtggctccgatgagtgatgtccgcctgttacctgtagg gtcatcacctcttgaggtggctgctgccagagcctgcgcagatattgaaa atacacctgttccgttacgccgcctgtggagtcctgacacctgtcctgca aatcttttgccgtggctggcgtgggcgttttccgttgaccgctgggatga gaactggccggaaaaaacaaagcgcgatgttattcgcagcgcgtatttca ctcactgccacaaaggcacgataggcgctgtcaggcgagttattgagccg ctcggatacataatcaacgttacggaatggtgggagacaggtgacccggc gggaacgtttcgtcttgatatcggtgtgctggaaagcggtattaccgaag aaatgtatttagaaatggagcggttgattgctgatgcgaaacctgcgagc cgtcatttgattggcctgaatattatccaggatattcccggttatatgta tacaggtggtgtgagctgtgacggcgacattattacagtttaccccggat aagtgaggaataatgagcacgaaatttaaaactattatcaccactgccgg agccgaaaaactggcagcggctactgtgccgggtggtaaaaaagtgaata tcaccgtgatggccgttggtgacggaggcggaaaactgccagtgccggac gccggtcaggtgcagctcgtgaatgaggtctggcgccatgccctgaataa aatcagccaggacaaccggaacagcaattacattgtagccgagctggtta ttccgcccgaggtgggaggattctggatgcgcgagttgggtctttatgat gacgagggcactctcattgctgttgccaatatggcagaaagctacaagcc agaacttgccgagggctcaggccgtgcgcagacatgtcgcatggtcatta ttgtcagcagtattgcctcagttgaattatccattgattcgacaatggta atggcgacgcaggaatatgttgatgacaggattgcggaacatgagaagtc acgtcgacatcctgacgccacactgaaagaaaaaggctttactcaactca gtagcgcaacagacagcgcgtctgaggtgcttgcggcgacgccgaaagcg gttaaagcggcgtatgaccttgctaatgctaaatataccgctcaggacgc gagcacagcgcaaaaaggcattgtgaggctgagtagtgcggcagacagta ccagtgaagctgaggccgcaacaccgaaagctgtcaaaattgcgatggat aatgcgaatgcgaggctggcaaaagaccggaacggcgctgatattccgaa tccgccgttgtttgtccagaatatcggtttaaaacccacggtcgataaag ctgctaatgccgttgataaaaatggcgacacgatgaacggaaacctgaca ctcaagggtgattaccggctgagttttattatccagaatgaagacggttc tattcgtgcttatatcttcaaggacaaaggtggcgacggtattcgcatca gtaatggcgatgacggcggcggtgattttgtttttggtaaaaatggacag ttttactgcccggatattatgcatgttggtaatacgattgtatggggtga cggaaatatcgagggggcgcgatggggcggtttgttgagcgactggttaa ctgctcaactggttgcccgtgacaataatattaacttgcgagcaccctat gaatgggttaaccaaaactttgtcaaccgtgcacagcgcggcgcacaggc cagcatgactatggacggcggacttgtagaggctccatggggatgttttc ttacgggggggaacggtaacgagggtaatcaggttggagtggctttatac cgtccattgcagattcttcgcaataatacttgggtaacgatagagaactg aaaatgaaactgattaatttgcaacgctacattctgatgaattatttttt aggtgatggcattcagtattttatagatgccacaggtaaggactggtata aatcactgcccaaattcacaaagaaatacagccttgctatcgaaaatgat acgggcgttattcgtagtatcagcgaagatgcatcccggctttatcccgg tggtttgaccgttgttgatgttgacagtattccggcaggttgtgacattt tcggcggatgggtatttgacggagagaaagtcattcctcgtgagtacaca ttggccgaacagcaacgccagtcagatgaaaagaaaaaaacacttcttgc tgaggcggaggcaacaatttccacgcttgagcgtgcggtaaggttaggca tggctaccggggaagaaataaggcgactcgaagcatgggagcgttacagc gtattggtgagcagggttaagcagtcagatgactggccgcaaaaacctga ataacccggcggcatttgcccgcttctttctcatccattagttgtgccag acatcatccagccctgacaaatagcccctcacaagaccagccaggacaat aacactcgcccactaactacggagttaaccggatgagtgattttcaccac ggcacgaaggtcatcgaaataaatgacggtacgcgtgttatttccacggt cgcaaccgcaatcgtcggcatggtctggacagccagcgatgcggatgccg agacatttcccctcaacgagccggtactgattaccaatgtgcagagcgcc attgcgaaagccggtaaaaaaggcactctgtcagcttccctgcaggccat cgccgaccagtcaaagcctgtcaccgttgtcgtgcgcgttgccgaaggta ccggagacgatgcagaagcgcagaccacgtccaacattatcggcggcacg gatgagaacggtaaatacaccggtatcaaggcgctgctaactgccgaagc ggtcaccggcgttaagccgcgcattctcggtgtgccgggtctcgatacgc aggaagtcgcaaccgcacttgcatcggtctgtatcagcctgcgtgcgttt ggttacgtcagcgcatggggctgtaagaccatttccgaggcgatggcata tcgcgagaatttcagccagcgcgagctgatggtcatctggcctgatttcc tcgcatgggataccaccgcgaacgccaccgccacggcatacgccaccgcc cgcgcactcggtctgcgtgcctacatcgaccagactatcggctggcacaa aacgctgtctaacgttggcgtgcagggcgttaccggcatcagcgcctcag tcttttgggatttgcaggcatccggcacagatgctgacctgctcaacgag gccggagtcaccacgctggtgcgcaaggatggtttccgtttttgggggaa ccgcacatgctctgatgacccgcttttcctgtttgagaactacacccgaa ccgcgcaggtgctggccgacacaatggctgaggcgcacatgtgggcggtc gataagcccatcaccgcatcgctcatccgtgacattgtcgacggcattaa cgccaaattccgcgagctgaaatcaaatggctacatcgtggacggtgaat gctggttcgacgaggaatcgaacgataaggaaaccctcaaggccgggaaa ctgtatatcgactacgactatacaccggttcccccactggaaagcctgac cctgcgccagcgtatcaccgataaatatctggtgaatctggctgaatcgg tcaacagctaaggagcctgaaacaacatggcactaccccgcaaacttaaa tatctgaacatgttcaatgacggccttagctacatgggcgttgttgaatc cgtgacgctgccgaagctgacccgcaagctcgaaaactatcgcggcggcg gtatgaatggcgctgcagcgattgacctcggcctcgacgatgatgcgctt actgtcgaatggtctgtcggtggcctgcctgatgtggcgctgtgggcgca gtatgccgcgccgggggctgatgccgtgccgctgcgttttgctggctctt accagcgtgacgacactggcgaaatcgttgcggtcgaggtggtcatgcgt ggccgtcataaagaaatcgacggcggcgaaaataagcagggtgaaaatac ctcgaccaaactgtcgaccgtttgcacctattaccgcctcacgattgatg gtagcgacattatcgaaatcgacaccgtcaacatggtcgagaaggtgaac ggcgtcgaccgtctggaacagcaccgccgcgcaatcgggctgctgtaatt ccctgaccggtcagcactgctggccggttattacccccattcagagcaga gaaaaaatcatggcaaaagcaccacgcaaaacccctgaatttattgatac ggctggcaatgaaattgacaccgtaaacccgaatgtcgtgaccctcgaca agccgattaaacgcgccggtcagacaattgaaaaggtcacgctgattgaa ccgaacgcaggcaccctgcgcggcgtcagtctggcggcggtggcgcagtc cgaggtcgatgcgctgattaaggtgctgccccgcatgacctacccggcac tcaccacgcaggagctcaccgcaatgaacctgcccgatatgctgtcgctg gccgctaaggtgattggttttttgtcaccggcttcggcggaatagacttc ccgcccggcctgtcgaccgatgacctgatggcggatatcgcagtgatatt ccactggccgccatcagagctctattccctgagcctgaccgagctcatca catggcgcgaaaaggcgctgcagcgtagcggaaaccacaatgagtaataa cctgaggcttgaggtattgctgaaagcggtcgaccaggcgacccgaccgc ttaaatccatccagaccgcgagtaaaagcctgtcgggcgatattcgcgac acacaaaaagggctgcgtgacctgaatggtcaggcgtcgaaaatcgacgg ctttcgtaaggcaagcgcgcaactggccgtaaccagtcaggcgcttgata aggcgaaacgcgaggccggtgagctggccgtgcagtttaaaaacaccacc aatccgacccgcgcgcaggcgcaggcacttgaagcggcaaggcgtgccgc ctctgagttgcagacgaaatacaacagcctgagaacgtcggtacagcgcc agcgctccgagctgatgcaggccggtattaatacccgcactctctctgca gatgagcgtcggctcaaaacctccatcagcgaaacaactgcgcacgttaa tcgacaacgtgaggcactggcgcgcgtcagtgcgcagcaggcgaaattaa gccgggtgaaagagcgatataaatcaggcaaggagcttgccggtaacatg gccgcagcaggcgctgcggggtcggtatcgcgacacggaacgatggccgg ggttaaattactgatgcccggttatgactttacgcagaaaaattccgagc tgcaggctgtgctcggggtcgataagcagtcgccagaaatgcaggcgtta cgcaaacaggcgcgccacgtcggcgacaatactgcagcctctgcagatga tgcagcaagcgcgcaaatcatcattgcgaaaagcggcggtgatgcagctg ccattcaggcgcgacgccgagtcacgctgaatatggcgctgtcaaaccgg cgcacgatggaggaaaacgcagcgctgctgaccgggatgaaatcagcgtt tcagctttcaaacgacaagattgcgcacattggcgacgttctctcgatga cgatgaacaaaaccgccgccgattttgacggactgagcgacgcgctgacc tatgccgcaccggtggcaaaaaatgccggggtgagcatcgagcaaaccgc cgcaatggtcggtgcactgcacgatgccaaaatcaccgggtcaatggcgg gcacgggtagccgcgccattctcagccgcctgcagctcccaccggaaaaa gcgtttgaggccattaaggagctcggcgtcaaaacgtcagacagcaaggg gaacacgcgcccgatattctccatcctgaaagaaatgcagcgcagctttg agaaaaacaacctcgggacaagccagcgcggcgagtatatgaaaaccatt ttcggcgaggaggccagctcggcggcggcggtactgatggaagccgcctc aagcggcaaacttgaccggctcaccgctgcgtttaaagcctcggacggta aaaccgaggaactggttaaggttatgcaggataacctcggcggcgacttt aaagagttccagtctgcttatgaggcagtcggtactgacctttttgacca gcaagagggctcgctgcgtaaactcacccaaaccgccacgcaatacgtgt taaagctcgacggctggatccagaagaacaaagggctggcgacaaccatt ggcatcatcgccggtggcgctctagctctgattggtatcatcggcggtat tggcctcgttgcgtggccggttgttatggggattaacgccattatcgctg ctgctggcgtgctgggtacggtctttactgttaccggtagtgccattgtg accgcacttggcgcgattacctggccgattgtcgcagtgggggcggctat tgtggctggtgcgttactcatccgtaaatattgggagcccatcagcgcat ttttctcgggggtgattgagggcatcatgagtgcctttgcaccggtcgca gaaatgttcgctccactggcacccatttttgacggtctcggtgagaaact gcgcggcgtctggcagtggtttaaagacctgatagcaccggtcaaagcca cgcaggaaacgctcgatagctgcaaaaatgtcggcgtcatatttggtcag gcgctggcctctgctttgatgcgtccgctcaatgtatttaacaagttgcg cagcggtgtcgactggcttctcgaaaagctcggtatcatcaacaaagagt cagacaacctcgaccagactgccgccaaaaccaacgccgccacgcagggt aattcctacatcccggcaaccagcacatatggcggctatcaagcttacca gccagttaccgcaccggcgggacgctcttacattgaccagagtaaaagcg aatacaaaatcactctgccgggaggtgctgcgccggggcatcagcttgac agacagctacgcgacacgctcgaacagattgagcgcgaaaagcgtgcgcg tcagcgtgccagtatgagccatgactgagaggaataaacgatgatgcttg cgcttggaatgtttgtgtttgaacgtcgcaccctgccttatcagtcgatg cagcactcgaaggattaccgctgggcgtctaatgaccgggtgggtaagcc gcctgcttatcagtttctcggcgagggggaaacgtcgatacagcttgccg gtacactgtacccagccatcaccggcggctggatctcactaaaggctgta gaggtaatggctaacgagggcagagcgtggccgttgattgagggaactgg aaacattttagggatgtatatcgtcgataaggtgtcgaccacgcacgccg agtttttcagcgacggcgctgccagaaagattgatttcaccctttcgctt aaacgggtcgacgaatcactgacggcaatgtttggcgacctgaataagca ggccagcgagcttctaggctctgccggaaatctgactgataagctgcaga gtgcgctcggaggactgaccgcatgattacgggcatgactattgacgccg gaactagccttgcaccggcatttatgttaacgctgaacagccaggacatt accagcaattttagtgaccggctgatttctctcaccatgacagacaaccg gggctttgaggctgaccagctcgacattgagctcgacgacaccgacggca aagtcgaattaccactgcgcggggcggtgctgacgttgtggcttggctgg cagggttcggcgcttctgaataagggcgatttcacggtcgatgagattga gcaccggggcgcgcctgatatcctgaccatccgcgcgcgtagtgcagact ttcgcggaacgctcaattcacggcgtgaagaatcatggcacgatactacc atcggtgagttggtcagcaccattgcaaagcgcaataaactgacggccag tgtcgcggattcactgaaaaaaattccggtaccgcatatcgaccagtcgc aggagtccgacgccgtatttctgacccgactggctgaccgcaatggggcg acggtgtcagtgaaagcggggaaactcctgtttctgaaagccggtagtgc gatgacggccagcggcaagcccgtcccgcaaatgacactaactcgcaacg atggtgaccgtcatcagtttgctattgccgaccgtggggcttacaccggc gtaaccgcaaaatggttgcacaccaaagacccgaagccgcaaaagcagaa agtaacactgaaacgcaagccaaaagagaagcacctgcgcgcactggagc acccgaaagcaaagccagtcagcaaaaagacaaaggccaaaaaagagccg gaagcgcgcgagggtgagtatatggccggtgaggccgataacgtgctggc gctgacgacggtctacgcttctaaggcgcaggcgatgcgtgccgctcagg ctaagtgggataagctgcagcgaggcgttgcggagttttcaattacgctg gcgcttggtagggctgatttattccctgagacaccggtgcgcgtatcagg ctttaagcgcgtcatagatgagcaggcatggttaatcagtaaggtaactc acaatctgaataatagcggcttcacgacgggcttagagcttgaggttaaa ctctctgatgtggagtacaacgcggaatcggatgatgaataaaatgtatt cacaaaaagtgaatttatgattatcatttattcacgaattgagaataaag ggtgggttatgtttcattgtccgaagtgccatcatgccgcacatgcgcga acaagccgctatctaaccgaaaacacgaaagaacgctaccaccagtgcca gaacatcaactgtagttgtacgtttatgacaatggaaacgatagagcgct ttattgttactccgggagccattgacccggcaccgcctcacccgactgtc ggtggtcagcggccattgtggctctgataaatttccgctaaatgcccgcc gcgtgcgggtttttttatgcactcaggaaagtggcggtaaaaaatccacc gccattctatcgccactcgaaaacgaggcaacaaaaaggccactcgagag agtggcctaactgtatgtatttactacttaaatttggtggcccctgctgg acttgaaccagcgaccaagcgattatgagttcctacaagaacaaccgaaa atcaatagtatgcgttatttatcattgacatagattgccattgtttgcca ataattacctattattcgccatttctaccgccactttatcgccattctat tatctgttactcagaaccatcgccgacataggttccatcaggtgcgagat gatatcttccaccaacataagtcccatctggggcaagtgttgggcggcca gcaacataacttccatttggcgctaagcgtggaacgccaccgacataagt tccatcgggtgcaaggcgtggtgctcctcctccaacataagtcccattag gggcaagcataggttgtccgtaaacataggtaccatcaggtgctaatcga actgacatacaacctccataacttatttgctgttagtaatgtgaactaaa ggatttagtttaactgcatcctctaaatggtcgggtgcaaagtgcgcata tcgcatggtcatttttatatctgtatggccgagtacgcgctgcaacacca aaatattaccgccattcatcataaagtgactagcgaaggtgtgacgtaaa acgtgggtaagttgtcctgccggtagttcgatacctgttctttccaaagc tgaccggaacgcgccataacaatcactgaacaaccggccctttttatcat caggcagagactcatagagctctttgctgattgggacggtgcgatttttt ctacctttcgtgttggtgtatgtgattttgtatttcgcgagttggctttt tctcagactctcggcctcagaccaccgtgcgccagttgcgagacagattc ttaccacggtttctaaatcagggtggtcatgtcggttacactctccgagc agttgcgaaatttggtcgtgagttagccaagtcatttccatttcttctgt gcggaatgggcgcatattttttagtgggttttcacccttccattctccga ggcggtttagctcattgaacaccgcccggaagtaggccagctcaagatta agcgtgcgaggcgatacctctttcactctgtttgaacgggcatactcacc ttttaaccgtttttctcggtagcgggaaaacatctgcgcatcgaaatcgc gtgcgagtggttcgcccatacactcaaaagcatggtgcatggctaactgg cgtttcaaaccatctttcagtgtaatgccatgagcgctataccatgaatc aaccagctcttttaacgtgcgcctgtcttccttttcttcctgccacgggt tttgaacggtgtactgctcaaacgccagagcctcgcctttagtagcgaat ttctttctgatacgtttgccttttgcaccgtttgggtagagttcacaaat ccaaccgccagccggatttttacggacggtcattagttaacctcgctgta tacacccaccacacgccccaacgttttaatatcatcaatgccgcattcga aaggaaccttcccgcctgcaacatgtagttttctacccggtagttttgtt aactctcgaatgcttattgctccctcaatgtcgactagccataagccgtc agacaatgatgcttgcttgtccacaaaataaattttcccctcggaacgga tagccatcccatctgtgagcggttttgtgaaaaattgggcatcaacactc aattgtttatcggatttgaggatttcttcacttaatgtgaatccctcaat cctttttgcgtcgctcgattctctgttatttacaaatgcttctccttctc cggtaagtaaccactggagattagcacctgtttcaagggcacagtgagcc gcaaagtcataggagatagcgcctcgggtgtacctgtttgacaatgagct ggacgcgatatcgaagtggttagctaattgaattttctgcgaaaatccgt acgcctcgcagatgcggtcaagtacatccacgttgctccatcctaaagaa tctattctcatttcgataaaacctatttactatctctcaattgggagata tattttggctaaacccacgcaattgatggcaagtgttggcaaacagagtc aaatcaattgcaaactttggctaatagggaatcatgcaatatggcttctg aaatcgcaatcatcaaagtgcctgcacctatcgttactctgcaacaattc gcagagcttgagggtgtttctgaacgcaccgcctaccgctggacaaccgg cgacaacccttgtgtaccaatcgaaccccgcacaatccgtaaaggctgca agaaagcaggtggcccgattcgcatttattacgcacgctggaaagaagag cagttgcgtaaggcgttgggacattcccgttttcaactcgtcatcggtgc ttaattcactttatgtgaattgtaaggatgcaacatgtttgattttcagg tttccaaacatccccactatgacgaagcgtgccgggcttttgcgcagcgt cacaacatggcgaagctggccgagcgtgcgggtatgaatgttcaaacgtt acgtaacaagctcaacccagaacagcctcaccagttcacgccgcctgaat tgtggctgctgactgacctgaccgaagactcaaccctcgttgatggtttt ctggcgcagattcattgtctgccatgcgtgccggttaatgagctggctaa agataaattgcagtcttacgtcatgcgcgcaatgagtgaactcggtgaac tggcgagcggtgcggtatctgatgagcgtctgaccactgcccgtaagcac aacatgattgaaagcgttaactccggcattcgcatgttgtcattgtcggc tctggcgctgcatgcacgtctgcagactaatcccgctatgtcgagcgtgg tcgataccatgagcggtattggcgcatcgtttggtctgatttgaggtgcg tatgctgaaaagtgaaccgtcatttgcgtctctgctcgttaagcaaagcc ccggtatgcattacggccacggctggatcgcaggtaaggacggcaagcgc tggcacccgtgccgctcacagtccgaattattaaaagggctgaaaacaaa gtcgccgaaatcgtcaggttttttaattattcgtattgtccactttgtaa ttaaaggagtgaaacatgtcacgcgatgaattaagaattgttttgggtgc catgattccaaatatggaggaaggttttgaaattaaaacccgcgacggcg caatacttcgcgttgaccctgagtgggagtgctgcaaagaatttaaggat ggattaaaagccgaaatcatcaagcagttaaaaagcaaacctgctgttgt atttggatatagttaattaattaaacgtaattacttggcgtaaacccgcc gggcattcttttgccaaaaaacaggaggatatatgagtcgaactatttat ttatcaacgccgagtggtgctggcgaccacttgctggagtctttgtttaa agaagccaaaaaagaagagcgcaaagaccgccgtctcgccgtttcaatcc gtctcgaagatctggccgttcacattaccaattcagatatgacaggcaaa gaagcggccgagctactgcgccgcgaagccactcgctttgagaacgaatc acaggagcttcactaatggccgacgcaatggatttagcacaactgcgcga gcaggaagaccgcgaacgccacataagcaacgcgcgcagccgtcgccatg aggtttctgcatttatctgtgaggaatgcgatgcacctatcccggaagcg cgccgccgagccataccgggcgtgcagtgctgcgttacctgtcaggaaat cttagagctgaaaagtaaacattataacggaggtgctttatgagcattac caatgcaactattagccagcgtgcaaaaaaatggcttgaagatgaccgta tatttattgacaccgaaactacgggtttgggtgatgatgcggaaatagta gaaatctgtttaatagatagcgctggttttatcatgctaaatacattggt taaaccaactaaaccaattccagcagaggctacggccattcatggaataa ctgatgaaatggttatgtatgcgccaacgtggaaagatattcacggcgca gtagcttctttattttttgagtatggctttgttatttataacgccgatta cgacacaagacttatatatcaaactgcgaaattatatgggcttgagaatg acggcttttgttattttttaaatgagcgttcggcctgcgccatgatgcta tatgcagagtatcgcggcgagccagggcgatttaaaggttataaatggca caaattagttgatgccgctgcacatgaaggggttagcgttgaaggaaagg cacaccgtgcattagcagattgccggatgactcttggcattatcgacgct ttggcaaaaggcggtgcagcatgagtatccgtatcgaaataggtgataaa tgggtaatcaccagcgaccaatatcaattcatcctgaatgaaaaaaaagt cgttaagaccggcaataaagctggcgaggaatggctcgacaccatcggtt attacccgaagattaatcagctcatttctggtctggtacatcaccacatt catacggcaatgattatttcccttagtgcaatggcagaggaaatagagaa gttatcttttatctgtgaagaagcatttaaggcggttaaaaaatgattga ttcccgctgctttgctgaaagcacaataaatattgtttctgtttctggtg gaaaggacagccttgctcaatggattcttgcggtagagaacgacgtaccg cgcaccactgtttttgcagataccgggcatgagcattcccaaacaatgga gtatctggattatcttgaatccagactcggcccggttattcgagtgaaag ccgattttactcggcggattgaaggcaaacggaaattcattgctgaaaaa tggcctgtctctctcgttgaagaatgcggaatgtctcatgagcaggctgc agaacgaatcgcaaaggcactggaaatccttaagccaaccggtaatccgt ttctcgatttgtgcatgtggaaaggacggttcccgagcacgaaagcaagg ttttgttcactggaactgaaacatgactcagtacgggacaagattgtact cccagcgctggagaaatatgacgaagtaattctatggcagggtgttcgtg ctcaggagtcaccagcccgcgctgcgttacctatgtgggaggaggatgca gataatacccccggtttgcatgtgtatcgcccaattcttaactggacaca tgaagacgtatttgccttagctaaacgacacggaattaaaccgaacccac tctatcagcaaggttgtagcagagttggctgcatgccatgtattcatgca agaaaatctgagctggcagagatttttgctcgctggccggaggagattgc gcgcgttgcagagtgggaacgtcttgttgctgcctgttcacgtcggggaa actcaacatttttcccttcgactcacgacccgcggcgagcagaaaaacgt attgaagttgttaccgtagaagaatatgggatagcttcatatcgtgactg ggcgatgactacgcgtggcggttctcagtacgatttgctcgctgctacaa acgacaaaactgtgtgcagtagcgtttatgccggtgtatgtgaatgacgg gtgtcgtttacgcgtttccgtggaatgccccacggtcggcaatagccagc tcatatcttacctatgaccaacagcatcgccgcgaccgtatgttcgcggc tttgctgcatgcgagaaaggtgctttttctccagccagaatgtgtgcgct ttgacgtttatcgcaccgctgcagttctggagcaaaatcagggcagtcaa cgagccaatgcctttttaatcagcttctgcaaaaaggcattaccacgtct tgaactggtcgcaaaaaaatacgagtgctcgggcatcaacagcaatgtat cagccgctgttttcgatggtcattttgatacccagcttatgcaatatctg gcgtcacgcatggtcaatatggtcgccagatttaaccgcctcccggatat gtcgcgcgccgatattgacctgctggccgcggatatcgctaattttattc gcgctgaactggccgacattgatgacaccggatttagcgaactcaaaacg ctgtacacttggtacatgcgcgccggttttatttccctgcaattcaacgt tacaccgccgaaatgggagcgtgtgactaaaaaatatttttgtgaggatg aaatcgcaccggcagtaatgcgcatgtttaatgaggtttggtggcgcggc cgcttgcgacgcattgcggctgcatggcgcgaacatctgcaaattgcagt cggcaacgtaagcaagaaacgacacgcatacgcgagtaaaaactgcgtca ccgactggcgcgagcagaagcgccgcacgcgcgaatttctcaaggggctg gatctcgaagacgaagaaggcaaccgcatcagtctgattgaaaaatacga cggctcggtcgctaatccagcaatacgccgctgtgagctgatggcccgca ttcgtgggtttgaaaatatctgtaatgagctcggttatgtcggggagttc tatactctgactgcaccgtctaaatatcacgccaccaccaaagcgggcta ccgtaacagcaaatggaacggtgcaagcccgtcagacacgcagagctatc tcacaggcctttgggcacgcatacgcgccaagctgcaccgggaagaaatc cgcattttcggaatacgcgtcgctgaaccgcatcacgatggaacgccgca ctggcatatgcttatgttcatgttgccggaagatgtcgagcgtgtgcgac tcatcatccgagattatgcgtgggaggaagaccactacgaactgagaagc gataaagccaaaaaggcgcgcttccatgctgaggccattgacccggaaaa aggcagtgctactggctatgtcgctaaatacatttccaaaaatatcgacg gttatgctctcgatggtgaaaccgatgacgaaagtggtgagttgttaaaa gagactgcacccgccgtttcagcatgggcggcgcgctggcacatccgtca gtttcaatttatcggcggtgcgccggtgacggtatacagggagctacgca gaatggctgaccctgaaacagccagggcgctcagtgttgaattcgccgca gtgcatgatgctgctcactatggacgctgggctgattatgtgaatgctca aggcggaccattcgttcgccgtgacgatttacaggtacgtacattgtatg aacctcgaactgaatttaatcagtatggcgaagaaactgtgtgcatcaaa ggtgtctacgatgcctcgataggtgctggctctcctattctaacccggtt aacgcagtggaagattgttccaaagcgtgccgttgatttggccgttgacg ttaagggcgcttctgcgccctctcggagttctgtcaataactgtacggga agcgaaagcgatccaccgatactcgatttaacaaaaccgctgagtcggcg tgaaagacgagagttgacgaaccgactcaggaagaaaaagccaacaacac ggcgaaaattcatccacggaacggataagcaaaacgtcgctataacgaaa actatcgacgagatacactctgacaaccggcatcacaatcagccggggcg aagccctgcacctgatggccggtggtaaaagttgttttaacggtcgatgg gtgcgcggaacgtcaaaaggtgaaatctttgctgcagctccttcacatca ggcgagacgcggaaaatccttaatcgtgttgcagatttagctgagctggc aacgaaaatgtaaccgctaatattcatccatatcatgtacatacagtgta tttaactgtgatttttttcttcacaccttttgccaatacgtgctactgta tgtttatacagtatctcgtagtggaggttgtgtggatagagagctaaatg agcacgttatgattgagcgggtcgaaatgattgcgcgtctgactgctgaa ggtacttgtcaggaaagagaccgtgaaatcgcattgaatctaattgcgga aatagcaagaggcaacctaatgaaaaataataatttttctgttgtttttt ccgcaccgcctgttggtgaaacatttgcaaaggagggcaaagtgaaagta aatatcacgttggataaagaccaaaaaatcggccagccggtaattgatgc ttttcagtgcgaattgaccaagcgaatacagtccgttttcccgtcaacgc gcgttactgttaaaaagggatccatgaccggtgtcgagctgatggggttc gataaagattcagaccgcgaagcgctggatagcatccttcaggaagtgtg ggaagatgagagctggcgttaatccctgaaaaatgtgcaaccatcgaccc catgtttgatagcatggggttgttttgtatgggattacacacaaaggaaa atcatggataccgtaatagcatttttatctctggctctctttattgcttt tatcgtcgggttaatcaagccgtcgctggttcgaatgccgagccgtaagc gctccagtgctgtttatctcggtggctgtctggcgctgggcgttattggc tcaatcttatggccgactgaaaaaactcagccggtggcaaaaactgacgt accggcggttaaagcggaaccggctacgccaacgtttgagtacgcagata aaaccctcaaagaatatcgcaacgagccaaaagaaacccggcacgaaatc gttaaagactatgttggattcaaaggtgtgcaggccagcgctaccgatgt tttttatgcctgtatgagcgagtacacttttaccaaagatgatgcgttaa agctcagtgatgtgttggggtggtgtttcaacgacttcgagaaagatcca caatctctgaataataaaatcaaccttgacgaatttcagggtaattttag cggttgggatggctcttatcgcccgttagagaagctgataaaagccagta tgaatgatgattcctcttataaacatgtttcaacggtctaccatctgatt ttgaataaagacccgcatgccgttgtaaaaacaacgtttcgcggcactaa tgcttatggtggcgtggtcaaacagaccgtagcagcacgcgtcaacgtgc gaacgggcgaggtcgattcaatactcgacaattaaacatgacaaacgccg ccggtgctgaaactcgctttcagtgctggcggggttgaacaacgagcccc gcgaggcgttagcctacccctgagcaaccgcccaagaccggtactattaa agccggtttttttatgccacttttccacgaatttcccgtttttttagccg tgcatgcaacaggtgcattgttttgcatgcgtcaggcttgcccgttctgg ttgtgcgtcgccagagctggcgcggctccagagtggtcatgcaactgcat taaaaccgacccataaagtgggca



Back to DNA page
Back to Homepage