M13tg130

- References:

Kieny M.P. , Lathe R. , Lecocq J.P. 1983. Gene 26: 91-99



bp 6231-6299: Polylinker EcoRI-SmaI-SacI-EcoRV-SphI-KpnI-XbaI-HindIII-BamHI-SalI-PstI


aatgctactactattagtagaattgatgccaccttttcagctcgcgcccc aaatgaaaatatagctaaacaggttattgaccatttgcgaaatgtatcta atggtcaaactaaatctactcgttcgcagaattgggaatcaactgttaca tggaatgaaacttccagacaccgtactttagttgcatatttaaaacatgt tgagctacagcaccagattcagcaattaagctctaagccatccgcaaaaa tgacctcttatcaaaaggagcaattaaaggtactctctaatcctgacctg ttggagtttgcttccggtctggttcgctttgaagctcgaattaaaacgcg atatttgaagtctttcgggcttcctcttaatctttttgatgcaatccgct ttgcttctgactataatagtcagggtaaagacctgatttttgatttatgg tcattctcgttttctgaactgtttaaagcatttgagggggattcaatgaa tatttatgacgattccgcagtattggacgctatccagtctaaacatttta ctattaccccctctggcaaaacttcttttgcaaaagcctctcgctatttt ggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttac tatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtg gtattcctaaatctcaactgatgaatctttctacctgtaataatgttgtt ccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactg gtataatgagccagttcttaaaatcgcataaggtaattcacaatgattaa agttgaaattaaaccatctcaagcccaatttactactcgttctggtgttt ctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgat ttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtca gccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaag ttggtcagttcggttcccttatgattgaccgtctgcgcctcgttccggct aagtaacatggagcaggtcgcggatttcgacacaatttatcaggcgatga tacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggt caaagatgagtgttttagtgtattctttcgcctctttcgttttaggttgg tgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctc atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgt tccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcct ttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcg atggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaa attcacctcgaaagcaagctgataaaccgatacaattaaaggctcctttt ggagcctttttttttggagattttcaacgtgaaaaaattattattcgcaa ttcctttagttgttcctttctattctcactccgctgaaactgttgaaagt tgtttagcaaaaccccatacagaaaattcatttactaacgtctggaaaga cgacaaaactttagatcgttacgctaactatgagggttgtctgtggaatg ctacaggcgttgtagtttgtactggtgacgaaactcagtgttacggtaca tgggttcctattgggcttgctatccctgaaaatgagggtggtggctctga gggtggcggttctgagggtggcggttctgagggtggcggtactaaacctc ctgagtacggtgatacacctattccgggctatacttatatcaaccctctc gacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatcc ttctcttgaggagtctcagcctcttaatactttcatgtttcagaataata ggttccgaaataggcagggggcattaactgtttatacgggcactgttact caaggcactgaccccgttaaaacttattaccagtacactcctgtatcatc aaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctt tccattctggctttaatgaagatccattcgtttgtgaatatcaaggccaa tcgtctgacctgcctcaacctcctgtcaatgctggcggcggctctggtgg tggttctggtggcggctctgagggtggtggctctgagggtggcggttctg agggtggcggctctgagggaggcggttccggtggtggctctggttccggt gattttgattatgaaaagatggcaaacgctaataagggggctatgaccga aaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaacttgatt ctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtt tccggccttgctaatggtaatggtgctactggtgattttgctggctctaa ttcccaaatggctcaagtcggtgacggtgataattcacctttaatgaata atttccgtcaatatttaccttccctccctcaatcggttgaatgtcgccct tttgtctttagcgctggtaaaccatatgaattttctattgattgtgacaa aataaacttattccgtggtgtctttgcgtttcttttatatgttgccacct ttatgtatgtattttctacgtttgctaacatactgcgtaataaggagtct taatcatgccagttcttttgggtattccgttattattgcgtttcctcggt ttccttctggtaactttgttcggctatctgcttacttttcttaaaaaggg cttcggtaagatagctattgctatttcattgtttcttgctcttattattg ggcttaactcaattcttgtgggttatctctctgatattagcgctcaatta ccctctgactttgttcagggtgttcagttaattctcccgtctaatgcgct tccctgtttttatgttattctctctgtaaaggctgctattttcatttttg acgttaaacaaaaaatcgtttcttatttggattgggataaataatatggc tgtttattttgtaactggcaaattaggctctggaaagacgctcgttagcg ttggtaagattcaggataaaattgtagctgggtgcaaaatagcaactaat cttgatttaaggcttcaaaacctcccgcaagtcgggaggttcgctaaaac gcctcgcgttcttagaataccggataagccttctatatctgatttgcttg ctattgggcgcggtaatgattcctacgatgaaaataaaaacggcttgctt gttctcgatgagtgcggtacttggtttaatacccgttcttggaatgataa ggaaagacagccgattattgattggtttctacatgctcgtaaattaggat gggatattatttttcttgttcaggacttatctattgttgataaacaggcg cgttctgcattagctgaacatgttgtttattgtcgtcgtctggacagaat tactttaccttttgtcggtactttatattctcttattactggctcgaaaa tgcctctgcctaaattacatgttggcgttgttaaatatggcgattctcaa ttaagccctactgttgagcgttggctttatactggtaagaatttgtataa cgcatatgatactaaacaggctttttctagtaattatgattccggtgttt attcttatttaacgccttatttatcacacggtcggtatttcaaaccatta aatttaggtcagaagatgaaattaactaaaatatatttgaaaaagttttc tcgcgttctttgtcttgcgattggatttgcatcagcatttacatatagtt atataacccaacctaagccggaggttaaaaaggtagtctctcagacctat gattttgataaattcactattgactcttctcagcgtcttaatctaagcta tcgctatgttttcaaggattctaagggaaaattaattaatagcgacgatt tacagaagcaaggttattcactcacatatattgatttatgtactgtttcc attaaaaaaggtaattcaaatgaaattgttaaatgtaattaattttgttt tcttgatgtttgtttcatcatcttcttttgctcaggtaattgaaatgaat aattcgcctctgcgcgattttgtaacttggtattcaaagcaatcaggcga atccgttattgtttctcccgatgtaaaaggtactgttactgtatattcat ctgacgttaaacctgaaaatctacgcaatttctttatttctgttttacgt gctaataattttgatatggttggttcaattccttccataattcagaagta taatccaaacaatcaggattatattgatgaattgccatcatctgataatc aggaatatgatgataattccgctccttctggtggtttctttgttccgcaa aatgataatgttactcaaacttttaaaattaataacgttcgggcaaagga tttaatacgagttgtcgaattgtttgtaaagtctaatacttctaaatcct caaatgtattatctattgacggctctaatctattagttgttagtgcacct aaagatattttagataaccttcctcaattcctttctactgttgatttgcc aactgaccagatattgattgagggtttgatatttgaggttcagcaaggtg atgctttagatttttcatttgctgctggctctcagcgtggcactgttgca ggcggtgttaatactgaccgcctcacctctgttttatcttctgctggtgg ttcgttcggtatttttaatggcgatgttttagggctatcagttcgcgcat taaagactaatagccattcaaaaatattgtctgtgccacgtattcttacg ctttcaggtcagaagggttctatctctgttggccagaatgtcccttttat tactggtcgtgtgactggtgaatctgccaatgtaaataatccatttcaga cgattgagcgtcaaaatgtaggtatttccatgagcgtttttcctgttgca atggctggcggtaatattgttctggatattaccagcaaggccgatagttt gagttcttctactcaggcaagtgatgttattactaatcaaagaagtattg ctacaacggttaatttgcgtgatggacagactcttttactcggtggcctc actgattataaaaacacttctcaagattctggcgtaccgttcctgtctaa aatccctttaatcggcctcctgtttagctcccgctctgattccaacgagg aaagcacgttatacgtgctcgtcaaagcaaccatagtacgcgccctgtag cggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgcta cacttgccagcgccctagcgcccgctcctttcgctttcttcccttccttt ctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccc tttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttg atttgggtgatggttcacgtagtgggccatcgccctgatagacggttttt cgccctttgacgttggagtccacgttctttaatagtggactcttgttcca aactggaacaacactcaaccctatctcgggctattcttttgatttataag ggattttgccgatttcggaaccaccatcaaacaggattttcgcctgctgg ggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtg aagggcaatcagctgttgcccgtctcgctggtgaaaagaaaaaccaccct ggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaa tgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaa cgcaattaatgtgagttagctcactcattaggcaccccaggctttacact ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaattt cacacaggaaacagctatgaccatgattacgaattcccgggagagctcga tatcgcatgcggtacctctagaagaagcttgggatccgtcgacctgcagc aattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgt tacccaacttaatcgccttgcagcacatccccctttcgccagctggcgta atagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctg aatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccgga aagctggctggagtgcgatcttcctgaggccgatacggtcgtcgtcccct caaactggcagatgcacggttacgatgcgcccatctacaccaacgtaacc tatcccattacggtcaatccgccgtttgttcccacggagaatccgacggg ttgttactcgctcacatttaatgttgatgaaagctggctacaggaaggcc agacgcgaattatttttgatggcgttcctattggttaaaaaatgagctga tttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatt taaatatttgcttatacaatcttcctgtttttggggcttttctgattatc aaccggggtacatatgattgacatgctagttttacgattaccgttcatcg attctcttgtttgctccagactctcaggcaatgacctgatagcctttgta gatctctcaaaaatagctaccctctccggcattaatttatcagctagaac ggttgaatatcatattgatggtgatttgactgtctccggcctttctcacc cttttgaatctttacctacacattactcaggcattgcatttaaaatatat gagggttctaaaaatttttatccttgcgttgaaataaaggcttctcccgc aaaagtattacagggtcataatgtttttggtacaaccgatttagctttat gctctgaggctttattgcttaattttgctaattctttgccttgcctgtat gatttattggatgtt



Back to DNA page
Back to Homepage