M13mp8

- References:

Messing,J. and Vieira,J. 1982. A new pair of M13 vectors for selecting either DNA strand of double-digest restriction fragments Gene 19:269-276



bp/ 1-5868 phage M13
5869-6230 lac-operon
6231-6266 M13mp8/pUC8-Polylinker/ EcoRI-SmaI-BamHI-SalI-PstI-HindIII
6269-6690 lac-operon
6691-7229 phage M13


aatgctactactattagtagaattgatgccaccttttcagctcgcgcccc aaatgaaaatatagctaaacaggttattgaccatttgcgaaatgtatcta atggtcaaactaaatctactcgttcgcagaattgggaatcaactgttaca tggaatgaaacttccagacaccgtactttagttgcatatttaaaacatgt tgagctacagcaccagattcagcaattaagctctaagccatccgcaaaaa tgacctcttatcaaaaggagcaattaaaggtactctctaatcctgacctg ttggagtttgcttccggtctggttcgctttgaagctcgaattaaaacgcg atatttgaagtctttcgggcttcctcttaatctttttgatgcaatccgct ttgcttctgactataatagtcagggtaaagacctgatttttgatttatgg tcattctcgttttctgaactgtttaaagcatttgagggggattcaatgaa tatttatgacgattccgcagtattggacgctatccagtctaaacatttta ctattaccccctctggcaaaacttcttttgcaaaagcctctcgctatttt ggtttttatcgtcgtctggtaaacgagggttatgatagtgttgctcttac tatgcctcgtaattccttttggcgttatgtatctgcattagttgaatgtg gtattcctaaatctcaactgatgaatctttctacctgtaataatgttgtt ccgttagttcgttttattaacgtagatttttcttcccaacgtcctgactg gtataatgagccagttcttaaaatcgcataaggtaattcacaatgattaa agttgaaattaaaccatctcaagcccaatttactactcgttctggtgttt ctcgtcagggcaagccttattcactgaatgagcagctttgttacgttgat ttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtca gccagcctatgcgcctggtctgtacaccgttcatctgtcctctttcaaag ttggtcagttcggttcccttatgattgaccgtctgcgcctcgttccggct aagtaacatggagcaggtcgcggatttcgacacaatttatcaggcgatga tacaaatctccgttgtactttgtttcgcgcttggtataatcgctgggggt caaagatgagtgttttagtgtattctttcgcctctttcgttttaggttgg tgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctc atgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgt tccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcct ttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcg atggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaa attcacctcgaaagcaagctgataaaccgatacaattaaaggctcctttt ggagcctttttttttggagattttcaacgtgaaaaaattattattcgcaa ttcctttagttgttcctttctattctcactccgctgaaactgttgaaagt tgtttagcaaaaccccatacagaaaattcatttactaacgtctggaaaga cgacaaaactttagatcgttacgctaactatgagggttgtctgtggaatg ctacaggcgttgtagtttgtactggtgacgaaactcagtgttacggtaca tgggttcctattgggcttgctatccctgaaaatgagggtggtggctctga gggtggcggttctgagggtggcggttctgagggtggcggtactaaacctc ctgagtacggtgatacacctattccgggctatacttatatcaaccctctc gacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatcc ttctcttgaggagtctcagcctcttaatactttcatgtttcagaataata ggttccgaaataggcagggggcattaactgtttatacgggcactgttact caaggcactgaccccgttaaaacttattaccagtacactcctgtatcatc aaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctt tccattctggctttaatgaagatccattcgtttgtgaatatcaaggccaa tcgtctgacctgcctcaacctcctgtcaatgctggcggcggctctggtgg tggttctggtggcggctctgagggtggtggctctgagggtggcggttctg agggtggcggctctgagggaggcggttccggtggtggctctggttccggt gattttgattatgaaaagatggcaaacgctaataagggggctatgaccga aaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaacttgatt ctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtt tccggccttgctaatggtaatggtgctactggtgattttgctggctctaa ttcccaaatggctcaagtcggtgacggtgataattcacctttaatgaata atttccgtcaatatttaccttccctccctcaatcggttgaatgtcgccct tttgtctttagcgctggtaaaccatatgaattttctattgattgtgacaa aataaacttattccgtggtgtctttgcgtttcttttatatgttgccacct ttatgtatgtattttctacgtttgctaacatactgcgtaataaggagtct taatcatgccagttcttttgggtattccgttattattgcgtttcctcggt ttccttctggtaactttgttcggctatctgcttacttttcttaaaaaggg cttcggtaagatagctattgctatttcattgtttcttgctcttattattg ggcttaactcaattcttgtgggttatctctctgatattagcgctcaatta ccctctgactttgttcagggtgttcagttaattctcccgtctaatgcgct tccctgtttttatgttattctctctgtaaaggctgctattttcatttttg acgttaaacaaaaaatcgtttcttatttggattgggataaataatatggc tgtttattttgtaactggcaaattaggctctggaaagacgctcgttagcg ttggtaagattcaggataaaattgtagctgggtgcaaaatagcaactaat cttgatttaaggcttcaaaacctcccgcaagtcgggaggttcgctaaaac gcctcgcgttcttagaataccggataagccttctatatctgatttgcttg ctattgggcgcggtaatgattcctacgatgaaaataaaaacggcttgctt gttctcgatgagtgcggtacttggtttaatacccgttcttggaatgataa ggaaagacagccgattattgattggtttctacatgctcgtaaattaggat gggatattatttttcttgttcaggacttatctattgttgataaacaggcg cgttctgcattagctgaacatgttgtttattgtcgtcgtctggacagaat tactttaccttttgtcggtactttatattctcttattactggctcgaaaa tgcctctgcctaaattacatgttggcgttgttaaatatggcgattctcaa ttaagccctactgttgagcgttggctttatactggtaagaatttgtataa cgcatatgatactaaacaggctttttctagtaattatgattccggtgttt attcttatttaacgccttatttatcacacggtcggtatttcaaaccatta aatttaggtcagaagatgaaattaactaaaatatatttgaaaaagttttc tcgcgttctttgtcttgcgattggatttgcatcagcatttacatatagtt atataacccaacctaagccggaggttaaaaaggtagtctctcagacctat gattttgataaattcactattgactcttctcagcgtcttaatctaagcta tcgctatgttttcaaggattctaagggaaaattaattaatagcgacgatt tacagaagcaaggttattcactcacatatattgatttatgtactgtttcc attaaaaaaggtaattcaaatgaaattgttaaatgtaattaattttgttt tcttgatgtttgtttcatcatcttcttttgctcaggtaattgaaatgaat aattcgcctctgcgcgattttgtaacttggtattcaaagcaatcaggcga atccgttattgtttctcccgatgtaaaaggtactgttactgtatattcat ctgacgttaaacctgaaaatctacgcaatttctttatttctgttttacgt gctaataattttgatatggttggttcaattccttccataattcagaagta taatccaaacaatcaggattatattgatgaattgccatcatctgataatc aggaatatgatgataattccgctccttctggtggtttctttgttccgcaa aatgataatgttactcaaacttttaaaattaataacgttcgggcaaagga tttaatacgagttgtcgaattgtttgtaaagtctaatacttctaaatcct caaatgtattatctattgacggctctaatctattagttgttagtgcacct aaagatattttagataaccttcctcaattcctttctactgttgatttgcc aactgaccagatattgattgagggtttgatatttgaggttcagcaaggtg atgctttagatttttcatttgctgctggctctcagcgtggcactgttgca ggcggtgttaatactgaccgcctcacctctgttttatcttctgctggtgg ttcgttcggtatttttaatggcgatgttttagggctatcagttcgcgcat taaagactaatagccattcaaaaatattgtctgtgccacgtattcttacg ctttcaggtcagaagggttctatctctgttggccagaatgtcccttttat tactggtcgtgtgactggtgaatctgccaatgtaaataatccatttcaga cgattgagcgtcaaaatgtaggtatttccatgagcgtttttcctgttgca atggctggcggtaatattgttctggatattaccagcaaggccgatagttt gagttcttctactcaggcaagtgatgttattactaatcaaagaagtattg ctacaacggttaatttgcgtgatggacagactcttttactcggtggcctc actgattataaaaacacttctcaagattctggcgtaccgttcctgtctaa aatccctttaatcggcctcctgtttagctcccgctctgattccaacgagg aaagcacgttatacgtgctcgtcaaagcaaccatagtacgcgccctgtag cggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgcta cacttgccagcgccctagcgcccgctcctttcgctttcttcccttccttt ctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccc tttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttg atttgggtgatggttcacgtagtgggccatcgccctgatagacggttttt cgccctttgacgttggagtccacgttctttaatagtggactcttgttcca aactggaacaacactcaaccctatctcgggctattcttttgatttataag ggattttgccgatttcggaaccaccatcaaacaggattttcgcctgctgg ggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtg aagggcaatcagctgttgcccgtctcgctggtgaaaagaaaaaccaccct ggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaa tgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaa cgcaattaatgtgagttagctcactcattaggcaccccaggctttacact ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaattt cacacaggaaacagctatgaccatgattacgaattcccggggatccgtcg acctgcagccaagcttggcactggccgtcgttttacaacgtcgtgactgg gaaaaccctggcgttacccaacttaatcgccttgcagcacatcccccttt cgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaac agttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcacca gaagcggtgccggaaagctggctggagtgcgatcttcctgaggccgatac ggtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatct acaccaacgtaacctatcccattacggtcaatccgccgtttgttcccacg gagaatccgacgggttgttactcgctcacatttaatgttgatgaaagctg gctacaggaaggccagacgcgaattatttttgatggcgttcctattggtt aaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatat taacgtttacaatttaaatatttgcttatacaatcttcctgtttttgggg cttttctgattatcaaccggggtacatatgattgacatgctagttttacg attaccgttcatcgattctcttgtttgctccagactctcaggcaatgacc tgatagcctttgtagatctctcaaaaatagctaccctctccggcattaat ttatcagctagaacggttgaatatcatattgatggtgatttgactgtctc cggcctttctcacccttttgaatctttacctacacattactcaggcattg catttaaaatatatgagggttctaaaaatttttatccttgcgttgaaata aaggcttctcccgcaaaagtattacagggtcataatgtttttggtacaac cgatttagctttatgctctgaggctttattgcttaattttgctaattctt tgccttgcctgtatgatttattggatgtt



Back to DNA page
Back to Homepage