M13mp18

- References: Yanisch-Perron C, Vieira J, Messing J. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119

Abstract: Three kinds of improvements have been introduced into the M13-based cloning systems. (1) New Escherichia coli host strains have been constructed for the E. coli bacteriophage M13 and the high-copy-number pUC-plasmid cloning vectors. Mutations introduced into these strains improve cloning of unmodified DNA and of repetitive sequences. A new suppressorless strain facilitates the cloning of selected recombinants. (2) The complete nucleotide sequences of the M13mp and pUC vectors have been compiled from a number of sources, including the sequencing of selected segments. The M13mp18 sequence is revised to include the G-to-T substitution in its gene II at position 6 125 bp (in M13) or 6967 bp in M13mp18. (3) M13 clones suitable for sequencing have been obtained by a new method of generating unidirectional progressive deletions VII.



bp/ 1-5868 phage M13
5869-6230 lac-operon
6231-6266 M13mp8/pUC8-Polylinker/ EcoRI-SacI-KpnI-SmaI-BamHI-XbaI-SalI-PstI-SphI-HindIII
6269-7250 lac-operon followed by phage M13


AATGCTACTACTATTAGTAGAATTGATGCCACCTTTTCAGCTCGCGCCCC AAATGAAAATATAGCTAAACAGGTTATTGACCATTTGCGAAATGTATCTA ATGGTCAAACTAAATCTACTCGTTCGCAGAATTGGGAATCAACTGTTACA TGGAATGAAACTTCCAGACACCGTACTTTAGTTGCATATTTAAAACATGT TGAGCTACAGCACCAGATTCAGCAATTAAGCTCTAAGCCATCCGCAAAAA TGACCTCTTATCAAAAGGAGCAATTAAAGGTACTCTCTAATCCTGACCTG TTGGAGTTTGCTTCCGGTCTGGTTCGCTTTGAAGCTCGAATTAAAACGCG ATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCT TTGCTTCTGACTATAATAGTCAGGGTAAAGACCTGATTTTTGATTTATGG TCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGAGGGGGATTCAATGAA TATTTATGACGATTCCGCAGTATTGGACGCTATCCAGTCTAAACATTTTA CTATTACCCCCTCTGGCAAAACTTCTTTTGCAAAAGCCTCTCGCTATTTT GGTTTTTATCGTCGTCTGGTAAACGAGGGTTATGATAGTGTTGCTCTTAC TATGCCTCGTAATTCCTTTTGGCGTTATGTATCTGCATTAGTTGAATGTG GTATTCCTAAATCTCAACTGATGAATCTTTCTACCTGTAATAATGTTGTT CCGTTAGTTCGTTTTATTAACGTAGATTTTTCTTCCCAACGTCCTGACTG GTATAATGAGCCAGTTCTTAAAATCGCATAAGGTAATTCACAATGATTAA AGTTGAAATTAAACCATCTCAAGCCCAATTTACTACTCGTTCTGGTGTTT CTCGTCAGGGCAAGCCTTATTCACTGAATGAGCAGCTTTGTTACGTTGAT TTGGGTAATGAATATCCGGTTCTTGTCAAGATTACTCTTGATGAAGGTCA GCCAGCCTATGCGCCTGGTCTGTACACCGTTCATCTGTCCTCTTTCAAAG TTGGTCAGTTCGGTTCCCTTATGATTGACCGTCTGCGCCTCGTTCCGGCT AAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGATGA TACAAATCTCCGTTGTACTTTGTTTCGCGCTTGGTATAATCGCTGGGGGT CAAAGATGAGTGTTTTAGTGTATTCTTTCGCCTCTTTCGTTTTAGGTTGG TGCCTTCGTAGTGGCATTACGTATTTTACCCGTTTAATGGAAACTTCCTC ATGAAAAAGTCTTTAGTCCTCAAAGCCTCTGTAGCCGTTGCTACCCTCGT TCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCCT TTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCG ATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAA ATTCACCTCGAAAGCAAGCTGATAAACCGATACAATTAAAGGCTCCTTTT GGAGCCTTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAA TTCCTTTAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTGAAAGT TGTTTAGCAAAACCCCATACAGAAAATTCATTTACTAACGTCTGGAAAGA CGACAAAACTTTAGATCGTTACGCTAACTATGAGGGTTGTCTGTGGAATG CTACAGGCGTTGTAGTTTGTACTGGTGACGAAACTCAGTGTTACGGTACA TGGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCTCTGA GGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTC CTGAGTACGGTGATACACCTATTCCGGGCTATACTTATATCAACCCTCTC GACGGCACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCC TTCTCTTGAGGAGTCTCAGCCTCTTAATACTTTCATGTTTCAGAATAATA GGTTCCGAAATAGGCAGGGGGCATTAACTGTTTATACGGGCACTGTTACT CAAGGCACTGACCCCGTTAAAACTTATTACCAGTACACTCCTGTATCATC AAAAGCCATGTATGACGCTTACTGGAACGGTAAATTCAGAGACTGCGCTT TCCATTCTGGCTTTAATGAAGATCCATTCGTTTGTGAATATCAAGGCCAA TCGTCTGACCTGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGG TGGTTCTGGTGGCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTG AGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGT GATTTTGATTATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGA AAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATT CTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTT TCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTAA TTCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATGAATA ATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCT TTTGTCTTTAGCGCTGGTAAACCATATGAATTTTCTATTGATTGTGACAA AATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCT TTATGTATGTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCT TAATCATGCCAGTTCTTTTGGGTATTCCGTTATTATTGCGTTTCCTCGGT TTCCTTCTGGTAACTTTGTTCGGCTATCTGCTTACTTTTCTTAAAAAGGG CTTCGGTAAGATAGCTATTGCTATTTCATTGTTTCTTGCTCTTATTATTG GGCTTAACTCAATTCTTGTGGGTTATCTCTCTGATATTAGCGCTCAATTA CCCTCTGACTTTGTTCAGGGTGTTCAGTTAATTCTCCCGTCTAATGCGCT TCCCTGTTTTTATGTTATTCTCTCTGTAAAGGCTGCTATTTTCATTTTTG ACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAATATGGC TGTTTATTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCG TTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCAAAATAGCAACTAAT CTTGATTTAAGGCTTCAAAACCTCCCGCAAGTCGGGAGGTTCGCTAAAAC GCCTCGCGTTCTTAGAATACCGGATAAGCCTTCTATATCTGATTTGCTTG CTATTGGGCGCGGTAATGATTCCTACGATGAAAATAAAAACGGCTTGCTT GTTCTCGATGAGTGCGGTACTTGGTTTAATACCCGTTCTTGGAATGATAA GGAAAGACAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGAT GGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCG CGTTCTGCATTAGCTGAACATGTTGTTTATTGTCGTCGTCTGGACAGAAT TACTTTACCTTTTGTCGGTACTTTATATTCTCTTATTACTGGCTCGAAAA TGCCTCTGCCTAAATTACATGTTGGCGTTGTTAAATATGGCGATTCTCAA TTAAGCCCTACTGTTGAGCGTTGGCTTTATACTGGTAAGAATTTGTATAA CGCATATGATACTAAACAGGCTTTTTCTAGTAATTATGATTCCGGTGTTT ATTCTTATTTAACGCCTTATTTATCACACGGTCGGTATTTCAAACCATTA AATTTAGGTCAGAAGATGAAATTAACTAAAATATATTTGAAAAAGTTTTC TCGCGTTCTTTGTCTTGCGATTGGATTTGCATCAGCATTTACATATAGTT ATATAACCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGACCTAT GATTTTGATAAATTCACTATTGACTCTTCTCAGCGTCTTAATCTAAGCTA TCGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCGACGATT TACAGAAGCAAGGTTATTCACTCACATATATTGATTTATGTACTGTTTCC ATTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAATTTTGTTT TCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAGGTAATTGAAATGAAT AATTCGCCTCTGCGCGATTTTGTAACTTGGTATTCAAAGCAATCAGGCGA ATCCGTTATTGTTTCTCCCGATGTAAAAGGTACTGTTACTGTATATTCAT CTGACGTTAAACCTGAAAATCTACGCAATTTCTTTATTTCTGTTTTACGT GCTAATAATTTTGATATGGTTGGTTCAATTCCTTCCATAATTCAGAAGTA TAATCCAAACAATCAGGATTATATTGATGAATTGCCATCATCTGATAATC AGGAATATGATGATAATTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCAA AATGATAATGTTACTCAAACTTTTAAAATTAATAACGTTCGGGCAAAGGA TTTAATACGAGTTGTCGAATTGTTTGTAAAGTCTAATACTTCTAAATCCT CAAATGTATTATCTATTGACGGCTCTAATCTATTAGTTGTTAGTGCACCT AAAGATATTTTAGATAACCTTCCTCAATTCCTTTCTACTGTTGATTTGCC AACTGACCAGATATTGATTGAGGGTTTGATATTTGAGGTTCAGCAAGGTG ATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGTTGCA GGCGGTGTTAATACTGACCGCCTCACCTCTGTTTTATCTTCTGCTGGTGG TTCGTTCGGTATTTTTAATGGCGATGTTTTAGGGCTATCAGTTCGCGCAT TAAAGACTAATAGCCATTCAAAAATATTGTCTGTGCCACGTATTCTTACG CTTTCAGGTCAGAAGGGTTCTATCTCTGTTGGCCAGAATGTCCCTTTTAT TACTGGTCGTGTGACTGGTGAATCTGCCAATGTAAATAATCCATTTCAGA CGATTGAGCGTCAAAATGTAGGTATTTCCATGAGCGTTTTTCCTGTTGCA ATGGCTGGCGGTAATATTGTTCTGGATATTACCAGCAAGGCCGATAGTTT GAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGAAGTATTG CTACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTC ACTGATTATAAAAACACTTCTCAAGATTCTGGCGTACCGTTCCTGTCTAA AATCCCTTTAATCGGCCTCCTGTTTAGCTCCCGCTCTGATTCCAACGAGG AAAGCACGTTATACGTGCTCGTCAAAGCAACCATAGTACGCGCCCTGTAG CGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTA CACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTT CTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCC TTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTG ATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTT CGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCA AACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAG GGATTTTGCCGATTTCGGAACCACCATCAAACAGGATTTTCGCCTGCTGG GGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTG AAGGGCAATCAGCTGTTGCCCGTCTCGCTGGTGAAAAGAAAAACCACCCT GGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAA TGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAA CGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACT TTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTT CACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCG GGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTC GTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCG CCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCC GCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGC TTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTG CGATCTTCCTGAGGCCGATACGGTCGTCGTCCCCTCAAACTGGCAGATGC ACGGTTACGATGCGCCCATCTACACCAACGTAACCTATCCCATTACGGTC AATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCAC ATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTT TTGATGGCGTTCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTA ACGCGAATTTTAACAAAATATTAACGTTTACAATTTAAATATTTGCTTAT ACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGGGTACATAT GATTGACATGCTAGTTTTACGATTACCGTTCATCGATTCTCTTGTTTGCT CCAGACTCTCAGGCAATGACCTGATAGCCTTTGTAGATCTCTCAAAAATA GCTACCCTCTCCGGCATTAATTTATCAGCTAGAACGGTTGAATATCATAT TGATGGTGATTTGACTGTCTCCGGCCTTTCTCACCCTTTTGAATCTTTAC CTACACATTACTCAGGCATTGCATTTAAAATATATGAGGGTTCTAAAAAT TTTTATCCTTGCGTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGG TCATAATGTTTTTGGTACAACCGATTTAGCTTTATGCTCTGAGGCTTTAT TGCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGATTTATTGGATGTT



Back to DNA page
Back to Homepage